当前位置:首页 >> 生物学 >>

pET


pET-3a-d Vectors
pET-3a DNA pET-3b DNA pET-3c DNA pET-3d DNA Cat. No. 69418-3 69419-3 69420-3 69421-3

TB026 12/98 The pET-3a-d vectors carry an N-terminal T7?Tag? sequence and BamH I cloning site. These vectors are the precursors to many pET family vectors; the pET-23a-d(+) series corresponds to pET-3a-d but incorporates several additional features. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-3a sequence landmarks

EcoR I(4638)

T7 promoter T7 transcription start T7?Tag coding sequence T7 terminator pBR322 origin bla coding sequence

615-631 614 519-551 404-450 2814 3575-4432

Aat II(4567) Ssp I(4449) Sca I(4125) Pvu I(4015)

Apo I(4638) Cla I(24) Hind III(29)

Bpu1102 I(458) BamH I(510) Nde I(550) Xba I(588) Bgl II(646) SgrA I(687) Sph I(843) EcoN I(903) Sal I(928) PshA I(993)

The maps for pET-3b, pET-3c and pET-3d are the same as pET-3a (shown) with the following exceptions: pET-3b is a 4639bp plasmid; subtract 1bp from each site beyond BamH I at 510. pET-3c is a 4638bp plasmid; subtract 2bp from each site beyond BamH I at 510. pET-3d is a 4637bp plasmid; the BamH I site is in the same reading frame as in pET-3c. An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 550 of pET-3c. As a result, Nco I cuts pET-3d at 546. For the rest of the sites, subtract 3bp from each site beyond position 551 in pET-3a. Nde I does not cut pET-3d.

Eam1105 I(3645)–

Ap (35 75 -

Pst I(3890)

) 32 44

pET-3a
(4640bp)
HgiE II(3338)

Eag I(1216) Nru I(1251) ApaB I(1329) BspM I(1331)

AlwN I(3168)

BspLU11 I(2752) Afl III(2752) Sap I(2636) Bst1107 I(2523) BsaA I(2504) Tth111 I(2497) BsmB I(2393) Pvu II(2343)

or

(2

i

81

4)

Bsm I(1636) Ava I(1702) Msc I(1723) Bpu10 I(1858) BscG I(1912)

T7 promoter primer #69348-3

Bgl II

T7 promoter

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA pET-3a BamH I Nde I T7?Tag Bpu1102 I TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGlyCysEnd pET-3d pET-3b pET-3c,d
Nco I

Xba I

rbs

...GGTCGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ...GlyArgAspProAlaAlaAsnLysAlaArgLysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd ...GGTCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ...GlyArgIleArgLeuLeuThrLysProGluArgLysLeuSerTrpLeuLeuProProLeuSerAsnAsnEnd

T7 terminator primer #69337-3

...TACCATGGCTAGC... MetAlaSer...

T7 terminator

CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-3a-d cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-3a Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsbI BscGI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 1 2 5 86 1 18 14 8 3 1 1 1 1 8 1 9 2 3 24 9 7 3 8 8 3 1 4 1 1 2 1 3 6 9 6 2 1 3 7 21 1 4 1 4 45 10 Locations 4567 929 2522 974 2261 2752 2402 2704 3944 Enzyme Cac8I CjeI CjePI ClaI CviJI CviRI DdeI # Sites Locations 32 18 22 1 24 79 21 10 458 479 3027 3436 DpnI 25 DraI 2 2445 2860 DsaI 2 805 1724 EaeI 6 295 676 4033 EagI 1 1216 Eam1105I 1 3645 EarI 2 2636 4440 EciI 4 1672 2826 Eco47III 4 234 773 Eco57I 2 3300 4312 EcoNI 1 903 EcoO109I 5 431 801 EcoRI 1 4638 EcoRII 6 129 1335 2912 EcoRV 2 187 378 FauI 11 FokI 12 FspI 4 262 1635 GdiII 5 295 676 HaeI 7 1197 1269 2778 3230 HaeII 11 HaeIII 23 HgaI 11 HgiEII 1 3338 HhaI 31 Hin4I 5 16 334 HincII 2 930 4186 HindIII 1 29 HinfI 11 HphI 12 MaeII 10 1178 1234 2503 3455 MaeIII 17 MboII 11 MmeI 4 222 309 MnlI 30 MscI 1 1723 MseI 18 MslI 7 1308 1739 4056 4415 MspI 28 MspA1I 7 462 1418 3339 4280 MwoI 37 NarI 4 691 712 NciI 10 171 812 2396 2431 NdeI 1 550 NgoAIV 4 678 1046 NheI 2 229 543 NlaIII 27 NlaIV 25 NruI 1 1251 NspI 4 843 2097 P?1108I 2 1035 3663 P?MI 2 1598 1647 PleI 5 629 917 PshAI 1 993 Psp5II 2 1716 1758 Psp1406I 4 1178 2077 PstI 1 3890 Enzyme PvuI PvuII RcaI RsaI SalI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII 1716 1718 1758 2778 4621 2899 T?I ThaI TseI Tsp45I Tsp509I 1733 808 1326 3867 1216 1723 4033 2767 Tth111I Tth111II UbaJI VspI XbaI XmnI # Sites 1 1 4 3 1 1 16 25 1 16 22 5 1 1 1 2 9 6 6 25 24 9 10 1 5 21 2 1 2 Locations 4015 2343 766 3472 165 2558 928 2636 4480 4125 4585

TB026 12/98

280 3070 2566 3168 1329 4638 1702 1076 2037 510 76 1043 752 1007 737 1675 399 3382 887 506 2363 230 3247 1212 646 1109 1858 458 613 2504 645 691 4564 115 1444 380 3936 2468 1912 2925 289 4015 1636 613 2393 829 513 3277 280 1746 380 1336 2752 1331 2685 3706 160 1560 2523 510 3490

868 4231 3066

1455 4316 4312

1746

2570

1858 3602

2020 4142

2560 4568

4125

808

1216

1721

1164 3783 119 1482 766 1870 830 3682 962 4250 1444 540 4150 448 3500 1446 1663

1413 4005 690 1566 4623 1267 3806 1132 3254 974 4184 544 3835 3765 2279

1716

1758

711 3593

825

2972 1054

3800 2006

138 687 843 4449 435 24 1404 947 4348 1129 2727

614

3017

3208

3886

1646 339 1545 2654 1283

643 2852 3993 1581

651 4296 4178 1802

929 4331 2306

1356 4093 2843

1663 3141

1008 589

2329 1766

124 2404 58 1610 2497 2213 629 588 2310

212 2499 251 3512 3342 3817 4244

1157 3901 580 3818 3349

1424 4112 630 4073 3381

2191 1596 4638 4637

3715

3706 651 712 129 1646 970 4188 4309 933 4164 4616 1219 1949 826 435 1724 1941

1418

3644

3718

1483 805 2912 2958

4182 811 3105

1823 3871

1847 4244

2077 4564

2967

3151

Enzymes that do not cut pET-3a: A?II AgeI ApaI BaeI BclI BmgI BsrGI BssHII BstEII DraIII DrdII FseI MluI MunI NcoI NspV PacI PmeI RsrII SacI SacII SgfI SmaI SnaBI Sse8387I StuI SunI XhoI

AscI BsaXI BstXI HpaI NotI PmlI SexAI SpeI SwaI

AvrII BseRI Bsu36I KpnI NsiI RleAI S?I SrfI XcmI

2668

3092

1934

2325

3897

2393 1150 545 3423 752 2570 1941 1413

3706 1375 658 3455 766 3070 2278

4482 2023 690 4549 868 4231 3245 4581 1455 4316

2343

2462

3094

826 1536 3132 1206

1483 1762 3828 1560

2090 4179

Bsp1286I 10 BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI Bst1107I BstYI 2 3 1 1 20 2 2 7 1 9

2389

2756

4486 3880 678 3725 646 3502

687

1046

1206

2646

3131

3634

1944 4270

3393 4287

3404

3871

4244

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-5a-c Vectors
pET-5a DNA pET-5b DNA pET-5c DNA Cat. No. 69426-3 69427-3 69428-3

TB029 12/98 The pET-5a-c vectors carry an N-terminal T7?Tag? sequence and BamH I/EcoR I cloning sites. The T7 terminator present on many other pET vectors is missing in the pET-5a-c series; therefore, β-lactamase is generally produced in large amounts in pET-5 recombinants induced for T7 RNA polymerase expression. The pET-23a-d(+) series corresponds to pET-5a-c but incorporates several additional features, including the T7 terminator (Cat. No. 69337-3). Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-5a(+) sequence landmarks

Apo I(4132)

T7 promoter T7 transcription start pBR322 origin bla coding sequence

109-125 108 2308 3069-3926
Ssp I(3943) Aat II(4061)

EcoR I(4132) BamH I(4) Nhe I(37) Nde I(44) Xba I(82) Bgl II(140) SgrA I(181) Sph I(337) EcoN I(397) Sal I(422) PshA I(487)

Ap (30 69 -

The maps for pET-5b and pET-5c are the same as pET-5a (shown) with the following exceptions: pET-5b is a 4133bp plasmid; subtract 1bp from each site beyond BamH I at 4. pET-5c is a 4132bp plasmid; subtract 2bp from each site beyond BamH I at 4.

Sca I(3619) Pvu I(3509)

39

) 26
Eag I(710) Nru I(745) ApaB I(823) BspM I(825)

Pst I(3384)

Eam1105 I(3139)–

pET-5a
(4134bp)
Bsm I(1130) Sty I(1140) Ava I(1196) Msc I(1217) Bpu10 I(1352) Bsg I(1406) BspE I(1435)

本资源由生物秀搜集整理并提供下载,仅供学习参考 本资源由生物秀搜集整理并提供下载,仅供学习参考
HgiE II(2832)

☆☆☆☆生物秀[? ww?bb?oo?co? ]? ww? .b? io? .c? m]? ☆☆☆☆生物秀[w? w.? bi? o.? om? ☆☆☆☆中国生物科学论坛[w? w.? bi? o.? om?bb? /]?AlwN I(2662) ww? .b? io? .c? m/? bs?]? ☆☆☆☆中国生物科学论坛[? ww?bb?oo?co? /b? s/? ☆☆☆☆生物秀下载频道[? ww?bb?oo?co? /S? ft?]? ☆☆☆生物秀下载频道[w? w.? bi? o.? om?So?t/? ww? .b? io? .c? m/? of?/]? ☆ 生物秀倾力打造最大最专业的生物资源下载平台! 生物秀倾力打造最大最专业的生物资源下载平台! ■■■选择生物秀,我秀我精彩! ■■■ !■ ■■■选择生物秀,我秀我精彩! ■■ !

o ri

(2 3

08 )
Pvu II(1837) BsmB I(1887) Tth111 I(1991) BsaA I(1998) Bst1107 I(2017)

Afl III(2246) BspLU11 I(2246) Sap I(2130)

T7 promoter primer #69348-3

Bgl II

T7 promoter

Xba I

rbs

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I Nhe I
T7?Tag

pET-5a

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAAT MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluPheLeuLysThrLysGlyProArgAspThrProIlePheIleGlyEnd
pBR322 EcoR I clockwise primer

BamH I EcoR I

pET-5b pET-5c

...GGTCGGGATCCGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAAT ...GlyArgAspProAsnSerEnd ...GGTCGGATCCGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAAT ...GlyArgIleArgIleLeuGluAspGluArgAlaSerEnd

pET-5a-c cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-5a Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 1 2 5 64 1 15 14 7 3 1 1 1 1 8 1 7 2 3 20 9 6 3 8 6 3 1 4 1 2 1 3 6 6 5 2 10 1 3 6 17 1 4 1 4 39 10 Locations 4061 423 2016 468 1755 2246 1896 2198 3438 Enzyme Cac8I CjeI CjePI CviJI CviRI DdeI # Sites Locations 29 18 16 68 20 8 1352 1514 3096 3636 DpnI 24 DraI 3 3005 3024 DrdI 2 1939 2354 DsaI 2 299 1218 EaeI 5 170 302 EagI 1 710 Eam1105I 1 3139 EarI 2 2130 3934 EciI 4 1166 2320 Eco47III 3 267 548 Eco57I 2 2794 3806 EcoNI 1 397 EcoO109I 4 295 1210 EcoRI 1 4132 EcoRII 5 829 1212 FauI 10 124 467 1261 1542 FokI 10 771 816 1791 1932 FspI 3 1129 1227 GdiII 4 170 302 HaeI 7 691 763 2272 2724 HaeII 10 188 209 980 1419 HaeIII 20 HgaI 11 HgiEII 1 2832 HhaI 28 Hin4I 3 912 3138 HincII 2 424 3680 HinfI 11 HphI 11 MaeII 10 672 728 1997 2949 MaeIII 15 MboII 11 MmeI 2 2461 2645 MnlI 25 MscI 1 1217 MseI 16 MslI 7 802 1233 3550 3909 MspI 24 MspA1I 6 912 1837 3774 MwoI 27 NarI 4 185 206 NciI 9 306 1030 1925 2626 NdeI 1 44 NgoAIV 4 172 540 NheI 1 37 NlaIII 25 NlaIV 21 NruI 1 745 NspI 4 337 1591 P?1108I 2 529 3157 P?MI 2 1092 1141 PleI 5 123 411 PshAI 1 487 Psp5II 2 1210 1252 Psp1406I 4 672 1571 PstI 1 3384 PvuI 1 3509 Enzyme PvuII RcaI RsaI SalI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII 1252 2272 669 1728 1465 3105 3361 710 820 269 1502 4115 2393 816 1949 1527 3286 3527 1217 323 2124 2406 1011 1959 1605 3573 T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II UbaJI VspI XbaI XmnI # Sites 1 4 2 1 1 14 24 1 14 19 4 1 1 1 1 7 6 6 24 20 7 8 1 4 19 2 1 2 Locations 1837 260 2966 2052 3619 422 2130 3974 4079

TB029 12/98

2054 4062 3716

2521

2930

362 3725 2060 2662 823 4132 1196 570 1531 4 184 1060 246 501 231 1169 456 3744 381 34 3644 38 3329 706 140 603 1352 107 1998 139 185 4058 299 2406 464 1962 299 2573 1406 2419 427 3658 1130 107 1887 323 7 2771 246 2064 1435 830 2246 825 2179 3200 172 3219 2017 4 2984

949 3810 2560

1240 3806

2064

2564

3619

710

1215

3527

658 3277 205 3087 260 1364 324 3176 626 938 468 3678 83 940 1157 3200 145 206 305 1435 3682 958 2919 3803 713

907 3499 319

1210

1252

2466 1500

3294

537

976

4117 761 3300 2337 2748 502 4134 1260 3259 1773 3209 850 3587 2635 1157 2876

108 181 337 3943 1140 137 2346 441 3842 623 2221

2511

2702

3380

145 3790 2148 777

423 3487 1075

898 3672 1296

1039 3825 1800

1823 2741

1857 2994

2261 550 2494

651 3395 74 3312 1991 1707 123 82 1804

918 3606 124 3567 2836 3311 3738

1685 1090 4132 2843

1898 1104

1993 3006

2875

3212

1443 320 938 2452 1222 3140 4110 2162

977 1140 2599 1607 3164

3676 1218 3430 1940 3686

1317 3365

1341 3738

1571 4058

Enzymes that do not cut pET-5a: A?II AgeI ApaI BaeI BclI BmgI BseRI BsrGI BssHII Bsu36I ClaI DraIII FseI HindIII HpaI MunI NcoI NotI PacI PmeI PmlI SacI SacII SexAI SmaI SnaBI SpeI StuI SunI SwaI

AscI Bpu1102I BstEII DrdII KpnI NsiI RleAI S?I SrfI XcmI

AvrII BsaXI BstXI EcoRV MluI NspV RsrII SgfI Sse8387I XhoI

2586

3509

1428

1819

3391

1956

2588

2833

1887 644 39 2917 260 2564 907

3200 869 152 2949 362 3725 1772

3976 1517 184 4043 949 3810 2739 4075 1240

320 1256 3322 700

977 1584 3673 1054

1890

Bsp1286I 9 BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI Bst1107I BstYI 1 3 1 1 18 2 2 6 1 9

1883

2250

3980 3374 181

2140

2625

3128

540

700

1054

3365

3738

140 2996

1438 3764

2887 3781

2898

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-9a-d Vectors
pET-9a DNA pET-9b DNA pET-9c DNA pET-9d DNA Cat. No. 69431-3 69432-3 69433-3 69434-3

TB040 12/98 The pET-9a-d(+) vectors carry an N-terminal T7?Tag? sequence and BamH I cloning site. These vectors are the precursors to many pET family vectors. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-9a sequence landmarks

T7 promoter T7 transcription start T7?Tag coding sequence T7 terminator pBR322 origin kan coding sequence

615-631 614 519-551 404-450 2814 3523-4335

EcoR I(4339) Pvu I(3954) Sgf I(3954) Ssp I(3879) Sma I(3828)

The maps for pET-9b, pET-9c and pET-9d are the same as pET-9a (shown) with the following exceptions: pET-9b is a 4340bp plasmid; subtract 1bp from each site beyond BamH I at 510. pET-9c is a 4339bp plasmid; subtract 2bp from each site beyond BamH I at 510. pET-9d is a 4338bp plasmid; the BamH I site is in the same reading frame as in pET-9c. An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 550 of pET-9c. As a result, Nco I cuts pET-9d at 546. For the rest of the sites, subtract 3bp from each site beyond position 551 in pET-9a. Nde I does not cut pET-9d.

Xho I(3552) Sph I(843) Sal I(928) Hinc II(930) PshA I(993)

HgiE II(3338) Eco57 I(3300)

ka

n

35) -43 23 5 (3

Bpu1102 I(458) BamH I(510) Nde I(550) Xba I(588) Bsa I(613) Bgl II(646) SgrA I(687)

pET-9a
AlwN I(3168)

– P?1108 I(1035)

(4341bp)

Eag I(1216) ApaB I(1329) BspM I(1331)

ori

Bsi I(2925)

Afl III(2752) BspLU11 I(2752) BsrB I(2685) Sap I(2636) Bst1107 I(2523) BsaA I(2504) Tth111 I(2497) Bsb I(2468) Pvu II(2343) Xmn I(2310)

(2

81

)

4
Msc I(1723) Bsg I(1912)

T7 promoter primer #69348-3

Bgl II

T7 promoter

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA pET-9a BamH I Nde I T7?Tag Bpu1102 I TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGlyCysEnd pET-9d pET-9b pET-9c,d
Nco I

Xba I

rbs

...GGTCGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ...GlyArgAspProAlaAlaAsnLysAlaArgLysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd ...GGTCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ...GlyArgIleArgLeuLeuThrLysProGluArgLysLeuSerTrpLeuLeuProProLeuSerAsnAsnEnd

T7 terminator primer #69337-3

...TACCATGGCTAGC... MetAlaSer...

T7 terminator

CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-9a-d cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-9a Restriction Sites
Enzyme AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 2 4 61 1 16 11 6 2 1 1 3 3 6 1 8 3 2 21 9 6 4 6 6 2 1 3 2 1 1 1 3 4 12 6 1 11 1 1 6 24 3 3 2 4 40 8 Locations 929 2522 974 2261 2752 2402 2704 # Sites Locations 2 24 3645 76 19 9 458 479 3027 3436 DpnI 19 DrdI 2 2445 2860 DsaI 2 805 1724 EaeI 5 295 676 EagI 1 1216 EarI 2 2636 3767 EciI 3 1672 2826 Eco47III 4 234 773 Eco57I 1 3300 EcoNI 2 903 3866 EcoO109I 4 431 801 EcoRI 1 4339 EcoRII 8 129 1335 2912 3842 EcoRV 2 187 378 FauI 11 FokI 11 FspI 3 262 1635 GdiII 4 295 676 HaeI 8 1197 1269 2778 3230 HaeII 11 HaeIII 21 HgaI 10 676 915 1656 2288 HgiEII 1 3338 HhaI 31 Hin4I 5 16 334 HincII 1 930 HindIII 2 29 4072 HinfI 15 HphI 12 MaeII 8 1178 1234 2503 3455 MaeIII 15 MboII 8 753 1007 3414 3754 MmeI 8 222 309 3790 4152 MnlI 29 MscI 1 1723 MseI 13 MslI 4 1308 1739 MspI 26 MspA1I 6 462 1418 3339 MwoI 38 NarI 4 691 712 NciI 10 171 812 2396 2431 NdeI 1 550 NgoAIV 4 678 1046 NheI 2 229 543 NlaIII 25 NlaIV 20 NruI 2 1251 3611 NsiI 2 3804 4070 NspI 4 843 2097 P?1108I 1 1035 P?MI 3 1598 1647 PleI 5 629 917 PshAI 1 993 Psp5II 2 1716 1758 Psp1406I 2 1178 2077 PvuI 1 3954 PvuII 1 2343 RcaI 2 766 3472 Enzyme ClaI CviJI CviRI DdeI Enzyme RsaI SalI SapI Sau96I Sau3AI ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II UbaJI VspI XbaI XhoI XmnI # Sites 3 1 1 11 19 18 25 4 1 1 1 1 1 2 12 3 10 25 21 8 12 1 7 19 2 1 1 1 Locations 165 2558 928 2636 3789

TB040 12/98

1858 3971

2020 4335

2560

280 3070 2566 3168 1329 3567 1702 1076 2037 510 76 1043 752 1007 737 1675 399 3382 887 506 2363 230 3247 1212 646 1109 1858 458 613 2504 645 691 380 4089 2468 1912 2925 289 3954 1636 613 2393 829 513 3277 280 1746 380 1336 2752 1331 2685 160 1560 2523 510 4203

868 3066

1455

1746

2570

808

1216

1721

3751 3552 1164

4339 3826 1413

2972 1054

2006

1716

1758

138 3954 687 3828 843 3879 435 947 1129 2727

614

3017

3208

1646 2654 1283 3865 4208 1581 3921

1716 1718 4199

1758 2778 2899

119 1482 766 1870 830 3728 962 1444 540 448 1446 1663 3971

690 1566 3609

711

825

1802 4093

2306 4184

1267 3771 1132 3254 974 544

1356 4212 2843 4273 1008 589

1663 3141

124 2404 2497 2213 3917 629 588 3552 2310

212 2499

1157 4101

1424

2191

1733 808 1326 4041

1216 1723

2767

3342 4338 4153

3349

3381

3790

2329 1766

1230 2445

1262 2863

1506 3441

2279

1418

3640

4182

651 712 970

1949 826 1941

1483 2958 3105

1823 3544 1278 3865 2967 4161

1847

2077

1870 3151

2623 3596

Enzymes that do not cut pET-9a: AatII A?II AgeI AvrII BaeI BclI BseRI BsrDI BsrGI BstXI Bsu36I DraI Eam1105I FseI HpaI MunI NcoI NotI PmeI PmlI PstI SacI SacII ScaI SnaBI SpeI SrfI SunI SwaI XcmI

ApaI BmgI BssHII DraIII KpnI NspV RleAI SexAI Sse8387I

AscI BsaXI BstEII DrdII MluI PacI RsrII S?I StuI

933

1219

2668

3092

1934 2343

2325 2462 3094

3838 2393 3970 1150 545 3423 752 2570 1941 1413

3915 3970 1375 658 3455 766 3070 2278 2023 690 868 3609 3245 1455

826 1536 3132 1206

1483 1762 3827 1560

2090 3828

Bsp1286I 9 BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrFI Bst1107I BstYI Cac8I CjeI CjePI 2 3 1 1 16 1 7 1 6 33 16 20

2389 4217 2646

2756

678 3908 646

687

1046

1206

3131

4186

1944

3393

3404

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-11a-d Vectors
pET-11a DNA pET-11b DNA pET-11c DNA pET-11d DNA Cat. No. 69436-3 69437-3 69438-3 69439-3

TB042 12/98 The pET-11a-d vectors carry an N-terminal T7?Tag? sequence and BamH I cloning site. These vectors are the precursors to many pET family vectors; the pET-21a-d(+) series corresponds to pET-11a-d but incorporates several additional features. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-11a sequence landmarks

T7 promoter T7 transcription start T7?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin bla coding sequence

432-448 431 328-360 213-259 835-1914 3851 4612-5469

Aat II(5604) Ssp I(5486) Sca I(5162) Pvu I(5052) Pst I(4927) Bsa I(4743)
Eam1105 I(4682) –

The maps for pET-11b, pET-11c and pET11d are the same as pET-11a (shown) with the following exceptions: pET-11b is a 5676bp plasmid; subtract 1bp from each site beyond BamH I at 319. pET-11c is a 5675bp plasmid; subtract 2bp from each site beyond BamH I at 319. pET-11d is a 5674bp plasmid; the BamH I site is in the same reading frame as in pET-11c. An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 359 of pET-11c. As a result, Nco I cuts pET-11d at 355. For the rest of the sites, subtract 3bp from each site beyond position 360 in pET-11a. Nde I does not cut pET-11d.

Ap

(4

9) 46 -5 2 61

EcoR I(5675) Cla I(24) Bpu1102 I(267) Hind III(29) BamH I(319) Nhe I(352) Nde I(359) Xba I(397) Bgl II(463) SgrA I(504) Sph I(660) EcoN I(720) Drd II(908)

Mlu I(1185) Bcl I(1199) BstE II(1366) Bmg I(1394) Apa I(1396) BssH II(1596) Hpa I(1691) BsaX I(1844)

835-1914) lacI (

AlwN I(4205) –

pET-11a
(5677bp)

o ri (
38
51

)
Eag I(2253) Nru I(2288) BspM I(2368) Bpu10 I(2895) Bsm I(2673) Ava I(2739) Msc I(2760)

BspLU11 I(3789) Sap I(3673) Bst1107 I(3560) BsaA I(3541) Tth111 I(3534)

PshA I(2030)

T7 promoter primer #69348-3

Bgl II

T7 promoter

lac operator

Xba I

rbs

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA pET-11a Nde I Nhe I T7?Tag
BamH I

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGlyCysEnd
T7 terminator primer #69337-3

Bpu1102 I

pET-11d

pET-11b pET-11c,d

...TACCATGGCTAGC... MetAlaSer...

Nco I

...GGTCGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ...GlyArgAspProAlaAlaAsnLysAlaArgLysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd ...GGTCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ...GlyArgIleArgLeuLeuThrLysProGluArgLysLeuSerTrpLeuLeuProProLeuSerAsnAsnEnd

T7 terminator

CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-11a-d cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-11a Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BclI BfaI BglI BglII BmgI BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I Bsp1286I BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI # Sites 1 1 7 89 2 24 16 8 4 1 1 2 2 1 9 1 12 3 5 27 15 7 5 10 1 7 3 1 1 6 1 1 1 1 3 8 10 7 1 2 13 3 3 6 22 1 7 2 4 50 14 11 2 3 1 1 26 3 4 Locations 5604 3559 952 1680 3741 4981 1185 3789 2011 3298 3439 # Sites Locations 8 160 495 2243 2597 BssHII 1 1596 Bst1107I 1 3560 BstEII 1 1366 BstXI 3 987 1116 BstYI 11 Cac8I 42 CjeI 28 CjePI 26 ClaI 1 24 CviJI 95 CviRI 26 DdeI 11 DpnI 29 DraI 3 4548 4567 DrdI 2 3482 3897 DrdII 1 908 DsaI 2 622 2761 EaeI 6 493 625 5070 EagI 1 2253 Eam1105I 1 4682 EarI 3 803 3673 EciI 5 962 2709 Eco47III 3 590 2091 Eco57I 2 4337 5349 EcoNI 1 720 EcoO109I 5 240 618 EcoRI 1 5675 EcoRII 10 129 908 2372 2755 EcoRV 2 187 1635 FauI 18 FokI 14 FspI 3 2672 2770 GdiII 5 493 625 HaeI 8 913 2234 3804 3815 HaeII 13 HaeIII 27 HgaI 15 HgiEII 2 783 4375 HhaI 44 Hin4I 5 16 1084 HincII 2 1691 5223 HindIII 1 29 HinfI 14 HpaI 1 1691 HphI 17 MaeII 12 MaeIII 18 MboII 15 MluI 1 1185 MmeI 2 4004 4188 MnlI 33 MscI 1 2760 MseI 24 MslI 10 1237 1525 2971 3362 MspI 35 MspA1I 10 271 1215 3380 3499 MwoI 45 NarI 5 508 529 NciI 14 NdeI 1 359 NgoAIV 4 495 2083 NheI 1 352 NlaIII 31 NlaIV 28 NruI 1 2288 Enzyme BsrFI 504 4762 871 2083 Enzyme NspI P?1108I P?MI PleI PshAI Psp5II Psp1406I PstI PvuI PvuII RcaI RsaI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII T?I 2753 1223 3815 2795 1763 3936 5658 1820 3949 ThaI TseI Tsp45I Tsp509I Tth111I Tth111II 2253 2363 5070 2760 UbaJI VspI XbaI XcmI XmnI 40 27 9 16 1 7 23 4 1 3 2 # Sites 4 2 3 7 1 2 5 1 1 3 4 4 1 21 29 1 24 24 5 1 1 1 2 12 8 7 Locations 660 3134 2072 4700 767 2635 446 734 4168 4671 2030 2753 2795 847 2215 4927 5052 1785 1878 583 4509 165 1332 3673 3426 2684 821 3793

TB042 12/98

1617

3683

1239

3114

4908

5281

685 4107 1165 4205 1396 869 1460 2739 1737 2795 319 569 1331

1169 5268 3603

2492 5353 4103

2783 5349

3607

3380 5517 3595

5622 5162

2366 5675 2113 3074 2201 4820 2450 5042 2753

5259

5162

1859

2253

2758

583 1670

1396 2044

2907

5660

208 4419 704 315 2045 1199 257 4537 2249 463 1394 1023 4752 2895 267 4743 3541 462 508 2520 115 1820 189 4142 1844 3505 1036 3962 1970 5201 2673 882 4743 1800 646

1999 5287 1045 349 3366 353 4872 2483

2169 1672 1477 3400 398 4802

3880 2481 1511 5187 2803

4178 4291 2011 5221 4284

5477 3863 3043

138 504 660 5486 244 1093 5215 1864 3343

431

4054

4245

4923

2683 1311 5368 2166 3764 1984 5385 2320 3691 2618 5030 2839

4009

4837

124 3441 3534 1024 4418 446 397 1041 3347

1366 3536

2194 4938

2461 5149

3228

1512

2146

2700

3316

4904 1859 2306 4267

1717 5674 1870 1557 5281

3250

4379

4386

1929 1575

4854

468 529 5219 129 2481 1504 4973 5225 1236 5346 2256

2986 643 5601 244 2683 2007

1142 622 2761 2978

1825 628 3949 3995

2455

4681

4755

2949 5653 3705

Enzymes that do not cut pET-11a: A?II AgeI AscI BseRI BsrGI Bsu36I KpnI MunI NcoI NspV PacI PmeI RsrII SacI SacII S?I SgfI SmaI SrfI Sse8387I StuI XhoI

AvrII DraIII NotI PmlI SalI SnaBI SunI

BaeI FseI NsiI RleAI SexAI SpeI SwaI

4129

5052

1287 5519 3430 2187

1413

1800

3430

1555 4934 1785 4131 643

2345 5093 1878 4376 1825

2776 5452 2455 5317 2520

2412

3060

189 2373 3789 2368 418 1232

2978 2450

3315

2243

2597

3722 1598

5523 4743

4917

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-12a-c Vectors
pET-12a DNA pET-12b DNA pET-12c DNA Cat. No. 69440-3 69441-3 69442-3

TB043 12/98 The pET-12a-c vectors carry an N-terminal ompT sequence for potential periplasmic export of target proteins. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/ expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-12a sequence landmarks

T7 promoter T7 transcription start ompT coding sequence T7 terminator pBR322 origin bla coding sequence

645-661 644 516-578 404-450 2848 3609-4466

Aat II(4601) Ssp I(4483) Sca I(4159)

EcoR I(4672) Apo I(4672) Cla I(24) Hind III(29)

Nhe I(229)

The maps for pET-12b and pET-12c are the Pst I(3924) same as pET-12a (shown) with the following exceptions: pET-12b is a 4673bp plasmid; subtract 1bp from each site beyond BamH I at 510. pET-12c is a 4675bp plasmid; add 1bp to each site beyond BamH I at 510. Eam1105 I(4682) –

Ap (36 09 -

) 66 44

Bpu1102 I(458) BamH I(510) Sal I(517) Avr II(562) Nde I(580) Xba I(618) Bgl II(676) SgrA I(717) Sph I(873) EcoN I(933) PshA I(1027)

pET-12a
(4674bp)
Eag I(1250) ApaB I(1363) BspM I(1365) HgiE II(3372)

AlwN I(3202)

Afl III(2786) BspLU11 I(2786) Sap I(2670) Bst1107 I(2557) BsaA I(2538) Tth111 I(2531) BsmB I(2427) Pvu II(2377)

or

(2

i

84

8)

Bsm I(1670) Msc I(1757) Bpu10 I(1892) Bsg I(1946)

T7 promoter primer #69348-3

Bgl II

T7 promoter

Xba I

rbs

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA Sal I ompT leader pET-12a Nde I Bpu1102 I BamH I TATACATATGCGGGCGAAACTCCTAGGAATAGTCCTGACAACCCCTATCGCGATCAGCTCTTTTGCGTCGACGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAG MetArgAlaLysLeuLeuGlyIleValLeuThrThrProIleAlaIleSerSerPheAlaSerThrGlySerGlyCysEnd pET-12b pET-12c
T7 terminator

...ACGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAG ...ThrAspProAlaAlaAsnLysAlaArgLysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd

signal peptidase

T7 terminator primer #69337-3

...ACGGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAG ...ThrGlyIleArgLeuLeuThrLysProGluArgLysLeuSerTrpLeuLeuProProLeuSerAsnAsnEnd

CATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 promoter primer #69348-3

pET-12a-c cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-12a Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaBI ApoI AvaI AvaII AvrII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 1 2 6 70 1 19 14 8 3 1 1 1 8 1 1 9 2 3 24 9 7 3 6 8 3 1 4 1 1 2 1 3 6 10 6 2 14 1 3 8 21 1 4 1 4 45 8 Locations 4601 518 2556 517 1008 3978 2786 Enzyme Bst1107I BstYI 2295 2436 2738 # Sites Locations 1 2557 9 510 676 3524 3536 Cac8I 32 CjeI 16 CjePI 20 ClaI 1 24 CviJI 79 CviRI 21 DdeI 10 458 479 3061 3470 DpnI 35 DraI 3 3545 3564 DrdI 2 2479 2894 DsaI 2 835 1758 EaeI 6 295 706 4067 EagI 1 1250 Eam1105I 1 3679 EarI 2 2670 4474 EciI 4 1706 2860 Eco47III 4 234 803 Eco57I 2 3334 4346 EcoNI 1 933 EcoO109I 5 431 831 EcoRI 1 4672 EcoRII 6 129 1369 2946 EcoRV 2 187 378 FauI 12 FokI 12 FspI 4 262 1669 GdiII 5 295 706 HaeI 7 1231 1303 2812 3264 HaeII 11 HaeIII 23 HgaI 12 HgiEII 1 3372 HhaI 33 Hin4I 6 16 334 3752 HincII 2 519 4220 HindIII 1 29 HinfI 11 HphI 12 MaeII 10 1212 1268 2537 3489 MaeIII 17 MboII 11 MmeI 4 222 309 MnlI 30 MscI 1 1757 MseI 18 MslI 7 1342 1773 4090 4449 MspI 28 MspA1I 7 462 1452 3373 4314 MwoI 36 NarI 4 721 742 NciI 10 171 842 2430 2465 NdeI 1 580 NgoAIV 4 708 1080 NheI 1 229 NlaIII 26 NlaIV 25 NruI 2 538 1285 NspI 4 873 2131 P?1108I 2 1069 3697 P?MI 2 1632 1681 1978 4304 3427 3438 Enzyme PleI PshAI Psp5II Psp1406I PstI PvuI PvuII RcaI RsaI SalI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I 1767 838 1360 3901 1250 1757 4067 2801 Tth111I Tth111II UbaJI VspI XbaI XmnI # Sites 5 1 2 4 1 2 1 4 3 1 1 16 27 1 16 22 5 1 1 1 3 11 6 6 25 24 9 10 1 5 21 2 1 2 Locations 659 947 1027 1750 1792 1212 2111 3924 963 4049 2377 796 3506 165 2592 517 2670 2680 3165

TB043 12/98

3668

3905

4278

280 3104 2600 3202 1363 4672 1736 1110 2071 562 510 76 1077 782 1041 767 1709 399 3416 917 1008 4218 230 3281 1246 676 1143 1892 458 643 2538 675 721 4598 115 841 380 3970 2502 1946 2959 289 3126 1670 643 2427 859 688 3489 280 1780 380 1370 2786 1365 2719 3740 160 1594

898 4265 3100

1489 4350 4346

1780

2604

4514 4159

4619 165

1892 3636 4256

2054 4176

2594 4602

4159

1198 3817

1447 4039

1750

1792

838

1250

1755

119 1516 796 1904 860 3716 996 4284 1478 1042 448 3534 1480 1697

720 1600 4657 1301 3840 1166 3288 2363 563 3869 3799 2313

741 3627

855

3006 1088

3834 2040

138 717 873 4483 435 981 4382 1163 2761

644

3051

3242

3920

562 2688 1317

1680 4027 1615 4212 1836 4365 2340

1390 4127 2877

1697 3175

1750 1752

1792 2812

4655 2933

2397 619

4184 1800

124 2438 58 1644 2531 2247 659 618 2344

212 2533 251 3546 3376 3851 4278

1191 3935 610 3852 3383

1458 4146 660 4107 3415

2225 1630 4672 4671

3749

3740 681 742 129 1478 1004 4222 1983 856 435 1680 1975

958

1452

3678

1517 562 1758 2992

4216 835 2946 3139

1857 3905

1881 4278

2111 4598

Enzymes that do not cut pET-12a: A?II AgeI ApaI BclI BmgI BsaXI BssHII BstEII BstXI DrdII FseI HpaI MunI NcoI NotI PacI PmeI PmlI SacI SacII SexAI SmaI SnaBI SpeI StuI SunI SwaI

AscI BseRI Bsu36I KpnI NsiI RleAI S?I SrfI XcmI

BaeI BsrGI DraIII MluI NspV RsrII SgfI Sse8387I XhoI

4343 963 4049

4650 967 4198

3001

3185

1253

2702

1968

2359

3931

2427 1184 720 4583 782 2604 1975 1447

3740 1409 3279 4615 796 3104 2312

4516 2057 3311 898 4265 3457 1489 4350

2377

2496

3128

Bsp1286I 10 BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI 2 3 1 1 19 2 2 7

856 1570 3166 1240

1517 1796 3862 1594

2124 4213

4520 3914 708 3759

2423

2790

717

1080

1240

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-14b Vector

TB044 12/98 The pET-14b vector (Cat. No. 69660-3) carries an N-terminal His?Tag? sequence followed by a thrombin site and three cloning sites. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-14b sequence landmarks

T7 promoter T7 transcription start His?Tag coding sequence Multiple cloning sites (Nde I -BamH I) T7 terminator pBR322 origin bla coding sequence

646-662 645 554-571 510-526 404-450 2845 3606-4463

Aat II(4598) Ssp I(4480) Sca I(4156) Pvu I(4046)

EcoR I(4669) Apo I(4669) Cla I(24) Hind III(29) Nhe I(229) Bpu1102 I(458) BamH I(510) Xho I(515) Nde I(522) Nco I(580) Xba I(619) Bgl II(677) SgrA I(718) Sph I(874) EcoN I(934) Sal I(959) PshA I(1024)

Eam1105 I(3676) –

Ap (36 06 -

Pst I(3921)

) 63 44

pET-14b
(4671bp)
HgiE II(3369)

Eag I(1247) Nru I(1282) ApaB I(1360) BspM I(1362)

AlwN I(3199)

BspLU11 I(2783) Afl III(2783) Sap I(2667) Bst1107 I(2554) BsaA I(2535) Tth111 I(2528) BsmB I(2424) Pvu II(2374)

or

(2

i

84

5)

Bsm I(1667) Msc I(1754) Bpu10 I(1889) Bsg I(1943)

T7 promoter primer #69348-3

Bgl II Nco I

T7 promoter His?Tag

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGCTCGAGGATCCGGCTGCTAACAAAGCCCGA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuValProArgGlySerHisMetLeuGluAspProAlaAlaAsnLysAlaArg
Bpu1102 I
thrombin T7 terminator

Xba I

rbs

Nde I

Xho I BamH I

AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG LysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd
T7 terminator primer #69337-3

pET-14b cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-14b Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 1 2 5 72 1 18 14 8 3 1 1 1 2 8 1 10 2 3 28 10 7 3 6 7 3 1 4 1 1 2 1 3 6 10 6 2 13 1 3 7 21 1 4 1 4 52 8 Locations 4598 960 2553 1005 2292 2783 2433 2735 3975 # Sites Locations 9 510 677 3521 3533 Cac8I 31 CjeI 16 CjePI 22 ClaI 1 24 CviJI 81 CviRI 21 DdeI 10 458 479 3058 3467 DpnI 25 DraI 3 3542 3561 DrdI 2 2476 2891 DsaI 3 580 836 EaeI 6 295 707 4064 EagI 1 1247 Eam1105I 1 3676 EarI 2 2667 4471 EciI 4 1703 2857 Eco47III 4 234 804 Eco57I 2 3331 4343 EcoNI 1 934 EcoO109I 5 431 832 EcoRI 1 4669 EcoRII 7 129 540 2930 2943 EcoRV 2 187 378 FauI 11 FokI 12 FspI 4 262 1666 GdiII 5 295 707 HaeI 7 1228 1300 2809 3261\ HaeII 11 HaeIII 24 HgaI 11 HgiEII 1 3369 HhaI 32 Hin4I 5 16 334 HincII 2 961 4217 HindIII 1 29 HinfI 11 HphI 12 MaeII 10 1209 1265 2534 3486 MaeIII 17 MboII 11 MmeI 4 222 309 MnlI 31 MscI 1 1754 MseI 18 MslI 7 1339 1770 4087 4446 MspI 28 MspA1I 8 462 548 3125 3370 MwoI 36 NarI 4 722 743 NciI 10 171 843 2427 2462 NcoI 1 580 NdeI 1 522 NgoAIV 4 709 1077 NheI 1 229 NlaIII 27 NlaIV 26 NruI 1 1282 NspI 4 874 2128 P?1108I 2 1066 3694 P?MI 2 1629 1678 PleI 5 660 948 Enzyme BstYI 1975 4301 3424 4318 3435 Enzyme PshAI Psp5II Psp1406I PstI PvuI PvuII RcaI RsaI SalI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII 1747 1366 1789 1749 4652 T?I 2809 ThaI TseI Tsp45I 1764 839 1357 3898 1247 1754 Tsp509I 4064 2798 Tth111I Tth111II UbaJI VspI XbaI XhoI XmnI 26 28 9 10 1 5 24 2 1 1 2 6 # Sites 1 2 4 1 1 1 4 3 1 1 16 25 1 17 22 5 1 1 1 3 10 6 Locations 1024 1747 1789 1209 2108 3921 4046 2374 797 3503 165 2589 959 2667 3902 4275

TB044 12/98

280 3101 2597 3199 1360 4669 515 1107 2068 510 76 856 783 1038 570 1694 399 3413 918 1005 4215 230 3531 1243 677 1140 1889 458 644 2535 676 722 4595 115 842 380 3967 2499 1943 2956 289 4046 1667 644 2424 860 689 3486 280 1777 380 1367 2783 1362 2716 3737 160 1591 2554

899 4262 3097

1486 4347 4343

1777

2601

4511 4156

4616

1889 3633 4253 1755 839

2051 4173

2591 4599

4156

1733 1195 3814 119 1074 797 1901 768 1706 993 4281 1475 1039 448 3866 1477 1694

1444 4036 537 1513 4654 861 3713 1163 3285 2360 620 3796 2310

1747

1789

1247

1752

721 1597

742 3624

3003 1085

3831 2037

1298 3837 2874

1387 4124 3172

138 718 874 4480 435 24 960 978 4379 1160 2758

645

3048

3239

3917

580 339 1435 2685 1314

1677 516 1576 4024 1612

674 2883 4209 1833

682 4327 4362 2337

2394 1797

4181 3278

3746

124 2435 58 1641 2528 2244 660 619 515 2341

212 2530 251 3543 3373 3848

1188 3932 611 3849 3380

1455 4143 661 4104 3412

2222 1627 4669 4668

3737 682 743 129 1475 1001 4219 1980 857 435 1677 1972

4275

1514 580 1755 2989

4213 836 2943 3136

1449

3675

3749 Enzymes that do not cut pET-14b: A?II AgeI ApaI BaeI BclI BmgI BsrGI BssHII BstEII DraIII DrdII FseI MluI MunI NotI PacI PmeI PmlI SacI SacII SexAI SmaI SnaBI SpeI StuI SunI SwaI AscI BsaXI BstXI HpaI NsiI RleAI S?I SrfI XcmI AvrII BseRI Bsu36I KpnI NspV RsrII SgfI Sse8387I

1854 3902

1878 4275

2108 4595

4340 964 4195

4647 1250

2998

3182

2699

3123

1965

2356

3928

2424 1181 721 4580 783 2601 1972 1444

3737 1406 3276 4612 797 3101 2309

4513 2054 3308 899 4262 3454 1486 4347

1449 4311 857 1567 3163

2374

2493

Bsp1286I 10 BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI Bst1107I 2 3 1 1 19 2 2 7 1

1514 1793 3859

2121 4210

1237

1591

4517 3911 709 3756

718

1077

1237

2420

2787

2677

3162

3665

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-15b Vector

TB045 5/99 The pET-15b vector (Cat. No. 69661-3) carries an N-terminal His?Tag? sequence followed by a thrombin site and three cloning sites. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-15b sequence landmarks

Bsa I(4774) Ahd I(4713)

Ap (4 6

T7 promoter T7 transcription start His?Tag coding sequence Multiple cloning sites (Nde I - BamH I) T7 terminator lacI coding sequence pBR322 origin bla coding sequence

463-479 452 362-380 319-335 213-259 (866-1945) 3882 4643-5500
Sca I(5193) Pvu I(5083) Pst I(4958)

Aat II(5635) Ssp I(5517)

EcoR I(5706) Cla I(24) Hind III(29)

0) 50 -5 43

Bpu1102 I(267) BamH I(319) Xho I(324) Nde I(331) Nco I(389) Xba I(428) Bgl II(494) SgrA I(535) Sph I(691) EcoN I(751)

Mlu I(1216) Bcl I(1230) BstE II(1397) Apa I(1427) BssH II(1627) Hpa I(1722)

866-1945) lacI (

AlwN I(4236)

pET-15b
(5708bp)

o ri (
38

82
)
BspLU11 I(3820) Sap I(3704) Bst1107 I(3591) Acc I(3590) BsaA I(3572) Tth111 I(3565) Bpu10 I(2926) Bsm I(2704) Msc I(2791) PshA I(2061) Eag I(2284) Nru I(2319) BspM I(2399)

T7 promoter primer #69348-3

Bgl II Nco I

T7 promoter His?Tag

lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGCTCGAGGATCCGGCTGCTAACAAAGCCCGA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuValProArgGlySerHisMetLeuGluAspProAlaAlaAsnLysAlaArg
Bpu1102 I
thrombin T7 terminator

Xba I

rbs

Nde I

Xho I BamH I

AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG LysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd
T7 terminator primer #69337-3

pET-15b cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-15b Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI 3431 BclI BfaI BglI BglII BmgI BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I Bsp1286I BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI # Sites 1 1 7 91 2 24 16 8 4 1 1 2 2 2 9 1 13 3 5 31 16 7 5 8 5218 1 6 3 1 1 6 1 1 1 1 3 8 11 7 1 2 13 3 3 6 22 1 7 2 4 57 12 11 2 3 1 1 25 3 4 8 Locations 5635 3590 983 1711 3772 5012 1216 3820 2042 3329 3470 Enzyme BssHII Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraI DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NarI NciI NcoI NdeI NgoAIV NlaIII NlaIV NruI NspI P?1108I P?MI # Sites 1 1 1 3 11 41 25 26 1 97 26 11 29 3 2 1 3 6 1 1 3 5 3 2 1 5 1 11 2 18 14 3 5 8 13 28 15 2 45 5 2 1 14 1 17 12 18 15 1 2 34 1 24 10 35 11 44 5 14 1 1 4 31 29 1 4 2 3 Locations 1627 3591 1397 1018 1147 Enzyme PleI # Sites Locations 7 477 765 4199 4702 PshAI 1 2061 Psp5II 2 2784 2826 Psp1406I 5 878 2246 PstI 1 4958 PvuI 1 5083 PvuII 3 1816 1909 RcaI 4 614 4540 RsaI 4 165 1363 SapI 1 3704 Sau96I 21 Sau3AI 29 ScaI 1 5193 ScrFI 25 SfaNI 24 SfcI 5 138 462 SgrAI 1 535 SphI 1 691 SspI 1 5517 StyI 3 244 389 TaqI 13 TaqII 8 1124 1342 5246 5399 5416 T?I 7 1895 2197 3374 3795 ThaI 41 TseI 31 Tsp45I 9 124 1397 3472 3567 Tsp509I 16 Tth111I 1 3565 Tth111II 7 1055 1748 4449 5705 UbaJI 26 VspI 4 477 1901 XbaI 1 428 XcmI 3 1072 1588 XhoI 1 324 XmnI 2 3378 5312 Enzymes that do not cut pET-15b: A?II AgeI AscI BseRI BsrGI Bsu36I KpnI MunI NheI NspV PacI PmeI RsrII SacI SacII S?I SgfI SmaI SrfI Sse8387I StuI 852 1648

TB045 5/99

3714

1270

3145

4939

5312

716 4138 1196 4236 1427 900 1491 324 1768 2826 319 600 1362

1200 5299 3634

2523 5384 4134

2814 5380

3638

24

3411 5548 3626

5653 5193

2397 5706 2770 2144 3105

2232 4851

2481 5073

2784

614 1701

1427 2075

2938

5691

208 4450 735 1508 5252 1230 257 4903 2280 494 1425 1054 4783 2926 267 4774 3572 493 539 2551 189 4173 1875 3536 1067 3993 2001 5232 2704 913 4774 1831 677

2030 5318 1076 1542

2200 1703 2042

3911 2512 2076

4209 4322 3397

4579 3513 939 389 524 5101 2284 4713 834 993 621 4368 751 240 5706 187

4598 3928 653 656

5290

2792 1890

4085

4276

4954

2284

2789

2714 2015 2351 3722 2649 5061 2870

3704 2740 2122 5380 649

5508 3894 3074

4040

4868

2784

2826

5689

1666

2225 4969

2492 5180

3259

429 2514

2834 4833

4315

4568

1543

2177

2731

3347

2703 524 944 3835

2801 656 2265 3846

4935 1890 2337 4298

3281

4410

4417

2284 2394

5101 2791

1960 1606

4885

814 16 1722 29 1722

4406 1115 5254 2486 4712 4786

499 560 5250 1535 5004 5256 1267 5377 2287

3017 674 5632 2038

1173

1856

3009

4026

AvrII DraIII NotI PmlI SalI SnaBI SunI

BaeI FseI NsiI RleAI SexAI SpeI SwaI

2980 5684 3736

1216 4035 2791 1268 3002

4219

4160

5083

1318 5550 3461 2218

1444

1831

3461

1556 3393

1586 4965

2376 5124

2807 5483

2443

3091

539 389 331 526

560

674

1856

2551

189 2404 3820 2399 449 1263 160 2274

3009 2481

3346

2114

2274

2628

3753 1629 526 2628

5554 4774 535 4793

4948 902

2114

2319 691 2103 798

3165 4731 2666

3457 2715

3824

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-16b Vector

TB046 2/00 The pET-16b vector (Cat. No. 69662-3) carries an N-terminal His?Tag? sequence followed by a Factor Xa site and three cloning sites. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-16b sequence landmarks

Eam1105 I(4716) –

Ap

T7 promoter T7 transcription start His?Tag coding sequence Multiple cloning sites (Nde I -BamH I) T7 terminator lacI coding sequence pBR322 origin bla coding sequence

466-482 465 360-389 319-335 213-259 869-1948 3885 4646-5503
Sca I(5196) Pvu I(5086) Pst I(4961) Bsa I(4777)

Aat II(5638) Ssp I(5520)

EcoR I(5709) Cla I(24) Hind III(29)

(4

3) 50 -5 6 64

Bpu1102 I(267) BamH I(319) Xho I(324) Nde I(331) Nco I(392) Xba I(431) Bgl II(497) SgrA I(538) Sph I(694) EcoN I(754) Drd II(942)

Mlu I(1219) Bcl I(1233) BstE II(1400) Bmg I(1428) Apa I(1430)

9-1 lacI (86 948)

AlwN I(4239) –

pET-16b
(5711bp)

o ri (

BssH II(1630) Hpa I(1725) BsaX I(1878) PshA I(2064) Eag I(2287) Nru I(2322) BspM I(2402) Bpu10 I(2929) Bsm I(2707) Msc I(2794)

388

5)
BspLU11 I(3823) Sap I(3707) Bst1107 I(3594) Acc I(3593) BsaA I(3575) Tth111 I(3568)

T7 promoter primer #69348-3 T7 promoter lac operator rbs Bgl II Xba I AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA His?Tag Nco I Nde I Xho I BamH I TATACCATGGGCCATCATCATCATCATCATCATCATCATCACAGCAGCGGCCATATCGAAGGTCGTCATATGCTCGAGGATCCGGCTGCTAACAAAGCC MetGlyHisHisHisHisHisHisHisHisHisHisSerSerGlyHisIleGluGlyArgHisMetLeuGluAspProAlaAlaAsnLysAla Factor Xa T7 terminator Bpu1102 I CGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG ArgLysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd T7 terminator primer #69337-3

pET-16b cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-16b Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BclI BfaI BglI BglII BmgI BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I Bsp1286I BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI # Sites 1 1 7 89 2 24 16 8 4 1 1 2 2 2 9 1 12 3 5 28 16 7 5 8 1 6 3 1 1 6 1 1 1 1 3 8 11 7 1 2 13 3 3 6 22 1 7 2 4 52 12 11 2 3 1 1 25 3 4 8 Locations 5638 3593 986 1714 3775 5015 1219 3823 2045 3332 3473 Enzyme BssHII Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraI DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NarI NciI NcoI NdeI NgoAIV NlaIII NlaIV NruI NspI P?1108I # Sites 1 1 1 3 11 41 26 28 1 96 26 11 29 3 2 1 3 7 1 1 3 5 3 2 1 5 1 10 2 18 14 3 6 8 13 29 15 2 44 5 2 1 14 1 17 12 18 15 1 2 34 1 24 10 35 11 44 5 14 1 1 4 31 28 1 4 2 Locations 1630 3594 1400 1021 1150 Enzyme P?MI PleI 1273 # Sites Locations 3 801 2669 7 480 768 4202 4705 PshAI 1 2064 Psp5II 2 2787 2829 Psp1406I 5 881 2249 PstI 1 4961 PvuI 1 5086 PvuII 3 1819 1912 RcaI 4 617 4543 RsaI 4 165 1366 SapI 1 3707 Sau96I 22 Sau3AI 37 ScaI 1 5196 ScrFI 24 SfaNI 24 SfcI 5 138 465 SgrAI 1 538 SphI 1 694 SspI 1 5520 StyI 3 244 392 TaqI 14 TaqII 8 1127 1345 5249 5402 T?I 7 1898 2200 3377 3798 ThaI 39 TseI 28 Tsp45I 9 124 1400 3475 3570 Tsp509I 16 Tth111I 1 3568 Tth111II 7 1058 1751 4452 5708 UbaJI 24 VspI 4 480 1904 XbaI 1 431 XcmI 3 1075 1591 XhoI 1 324 XmnI 2 3381 5315 Enzymes that do not cut pET-16b: A?II AgeI AscI BseRI BsrGI Bsu36I KpnI MunI NheI NspV PacI PmeI RsrII SacI SacII S?I SgfI SmaI SrfI Sse8387I StuI 2718 855 1651

TB046 2/00

3717

3148

4942

5315

719 4141 1199 4239 1430 903 1494 324 1771 2829 319 603 1365

1203 5302 3637

2526 5387 4137

2817 5383

3641

24

3414 5551 3629

5656 5196

2400 5709 2773 2147 3108

2235 4854

2484 5076

2787

617 1704

1430 2078

2941

5694

208 4453 738 1511 3434 1233 257 4906 2283 497 1428 1057 4786 2929 267 4777 3575 496 542 2554 189 4176 1878 3539 1070 3996 2004 5235 2707 916 4777 1834 680

2033 5321 1079 1545 5221 432 2517

2203 1706 2045 5255 2837 4836

3914 2515 2079

4212 4325 3400

4318

4571

4582 3516 942 392 349 2792 2287 4716 837 996 624 4371 754 240 5709 129 2406 187

4601 3931 656 527 5104

5293

2795 659

1893

2287

4088

4279

4957

3707 2743 2125 5383 652 942 2789 1669

5511 3897 3077

2717 2018 5419 2354 3725 2652 5064 2873

4043

4871

2787 1257 3849

2829 1797 3970

5692 1854 3983

2228 4972

2495 5183

3262

1546

2180

2734

3350

2706 349 5104 947 3838

2804 527 2268 3849

4938 659 2340 4301

3284

4413

4420

1893 2397

2287 2794

1963 1609

4888

502 563 5253 1538 5007 5259 1270 5380 2290

3020 677 5635 2041

817 16 1725 29 1725

4409 1118 5257 2489 4715 4789 AvrII DraIII NotI PmlI SalI SnaBI SunI BaeI FseI NsiI RleAI SexAI SpeI SwaI

1176

1859

3012

4029

2983 5687 3739

4163

5086

1219 4038 2794 1271 3005

4222

1321 5553 3464 2221

1447

1834

3464

1559 3396

1589 4968

2379 5127

2810 5486

2446

3094

542 392 331 529

563

677

1859

2554

189 2407 3823 2402 452 1266 160 2277

3012 2484

3349

2117

2277

2631

3756 1632 529 2631

5557 4777 538 4796

4951 905

2117

2322 694 2106

3168 4734

3460

3827

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-17b Vector

TB047 12/98 The pET-17b vector (Cat. No. 69663-3) carries an N-terminal 11aa T7?Tag? sequence followed by a region of useful cloning sites. Included in the multiple cloning region are dual BstX I sites, which allow ef?cient cloning using an asymmetric linker (1). Unique sites (except for the two BstX I sites) are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circluar map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.
1. Seed, B. (1987) Nature 329, 840.

pET-17b sequence landmarks

T7 promoter T7 transcription start T7?Tag coding sequence Multiple cloning sites (Hind III - Xho I) T7 terminator pBR322 origin bla coding sequence

333-349 332 237-269 141-228 28-74 1480 2241-3098

Sty I(59) Bpu1102 I(82)

Aat II(3233) Ssp I(3115)

Hinc II(2852) Sca I(2791)

Pvu I(2681)

Ap (22 4130 98 )

Xho I(141) Not I(147) BstX I(160) EcoR V(166) EcoR I(174) BstX I(186) Spe I(199) BamH I(205) Ban II(215) Sac I(215) Kpn I(221) Hind III(223) Nhe I(261) Nde I(268) Xba I(306) Bgl II(364) Msc I(389) Dsa I(390) Bpu10 I(524) Bsg I(578) Eco47 III(672) BsmF I(689)

Bgl I(2431) BsrF I(2391)
P?1108 I(2329) – Eam1105 I(2311) –

pET-17b
(3306bp)
BspG I(944) Pvu II(1009) BsmB I(1059) Tth111 I(1163) BsaA I(1170) Acc I(1188) Bst1107 I(1189) Sap I(1302) BspLU11 I(1418) Afl III(1418)

HgiE II(2004) AlwN I(1834)

o ri ( 1

480

)

T7 promoter primer #69348-3

Bgl II Nde I Nhe I

T7 promoter T7?Tag

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATTCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAG MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgAspSerSerLeuValProSerSerAspProLeuValThrAlaAlaSerValLeuGluPheCysArgTyrProSerHisTrpArgProLeuGlu
Bpu1102 I
T7 terminator

Xba I

rbs

Hind III

Kpn I Sac I BamH I Spe I

BstX I

EcoR I

EcoR V

BstX I

Not I

Xho I

CAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG GlnIleArgLeuLeuThrLysProGluArgLysLeuSerTrpLeuLeuProProLeuSerAsnAsnEnd
T7 terminator primer #69337-3

pET-17b cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-17b Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsbI BscGI BsgI BsiI BsiEI BslI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 1 1 4 44 1 16 13 6 3 1 1 2 5 1 2 1 2 20 4 5 2 6 8 1 1 2 1 1 2 1 3 2 3 5 2 9 1 3 6 10 4 1 1 31 8 Locations 3233 1188 927 1068 1418 1370 2610 Enzyme DpnI DraI DrdI DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoO109I EcoRI EcoRII EcoRV FauI FokI 2472 1807 995 262 2501 2759 2048 1029 307 FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HphI 363 3230 390 607 2854 394 2312 2975 194 391 1440 1059 615 1578 1624 779 2336 3282 1334 754 1458 2372 KpnI MaeII 1771 1112 2858 2602 1745 MaeIII MboII MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NciI NdeI NheI NlaIII NlaIV NotI NspI P?1108I PleI Psp5II Psp1406I PstI PvuI PvuII RcaI RsaI SacI SapI Sau96I Sau3AI 14 8 2 19 1 16 6 16 6 15 7 1 1 16 13 1 3 1 4 2 3 2 1 1 3 3 1 1 10 19 1 8 # Sites 19 3 2 1 4 2 1 2 3 1 2 4 1 4 1 6 8 2 3 4 4 13 5 1 17 3 1 1 8 8 Locations 2177 1111 390 147 147 2311 1302 1492 672 1966 55 174 384 166 348 1131 637 2277 399 147 389 591 954 2004 210 2852 223 229 1393 463 2797 221 489 2537 536 2984 1633 389 405 3081 86 2946 428 2494 268 261 600 991 2563 2722 2196 1526 191 191 3106 1638 2978 382 1444 433 699 2458 2533 191 1433 674 1111 2888 Enzyme ScaI ScrFI SfaNI SfcI SpeI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I 1121 1104 Tth111I Tth111II UbaJI VspI XbaI XhoI XmnI # Sites 1 11 13 5 1 1 1 4 5 4 12 20 5 7 1 4 11 2 1 1 2 Locations 2791

TB047 12/98

387

2699

215 2982 1232 1834 174 141 382 205 217 215 536 162 23 179 224 2850 72 1913 2431 364 945 524 82 331 1170 164 2848 59 4 1134 46 2091 578 1591 150 2830 52 1067 331 1059 689 231 2121 215 2982 4 944 1418 146 2372 2391 1189 160 134 2070

412 1732

1236 2978

1736

2897

2466

169 199 3115 59 142 1320 229

332

1683

1874

2552

361 2659 468

1518 2844 972

2962 2997 1393

3014

424 1565 714 777 2745 2699 1444 1296 1529

3287 1578 900 963

368 424 2259 3289 2348 1509 1920 258 200 2166

703

2449

2671

857 174 2739 1163 879 347 306 141 976

1070 298 3304 2008 2483

1165 348

2567 2178

2778 2484

2015

2047

2916 2816 432

1896 1666 2107 2837

2910

2310

2384

2381

2372

339 1789 1038 3003 513 2910 1289 3093 1817

468 2306 1047 3038 743 3230 2080 3289

972 2154

1318 2381

Enzymes that do not cut pET-17b: A?II AgeI ApaI AvrII BaeI BclI BseRI BsmI BspMI BstEII Bsu36I ClaI EcoNI FseI HpaI NarI NcoI NgoAIV NspV PacI P?MI PshAI RleAI RsrII SexAI S?I SgfI SnaBI SphI SrfI SunI SwaI XcmI

ApaBI BmgI BsrGI DraIII MluI NruI PmeI SacII SgrAI Sse8387I

AscI BsaXI BssHII DrdII MunI NsiI PmlI SalI SmaI StuI

1169

2121

2151

2906

1758 845 1624 3148

2681 887 1903

1009

1128

1760

2005

Bsp1286I 6 BspEI BspGI BspLU11I BsrI BsrBI BsrDI BsrFI Bst1107I BstXI BstYI Cac8I CjeI CjePI CviJI CviRI DdeI 2 1 1 16 3 2 1 1 2 10 12 14 14 52 14 10

263 3215 412 607

1911 3247 1236

1943 1736

2089 2897

756 2845

1062

1097

1798

1351 2546

3152

186 205 2156

364 2168

610 2936

2059 2953

82 1693

103 2102

524 2268

686 2808

1226 3234

147 763 2329 347 382 743 173 2681 1009 2138 219 215 1302 55 2353

1055 1312 424 2537 2556

1422 1797 2910 2300

3146 1224

3251 2791

382 2432

424 2449

703 2671

890 3287

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-17xb Vector

TB048 12/98 The pET-17xb vector (Cat. No. 69664-3) carries an N-terminal 260aa T7 gene 10 sequence (including the T7?Tag? region) followed by a region of useful cloning sites. Included in the multiple cloning region are dual BstX I sites, which allow ef?cient cloning using an asymmetric linker (1). Unique sites (except for the two BstX I sites) are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circluar map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.
1. Seed, B. (1987) Nature 329, 840.

pET-17xb sequence landmarks

Bpu1102 I(82)

T7 promoter T7 transcription start T7 gene 10 coding sequence Multiple cloning sites (Sac II - Xho I) T7 terminator pBR322 origin bla coding sequence

1080-1096 1079 237-1016 141-238 28-74 2227 2988-3845
Aat II(3980) Ssp I(3862) Hinc II(3599) Sca I(3538)

Xho I(141) Not I(147) BstX I(160) EcoR V(166) EcoR I(174) BstX I(186) Spe I(199) BamH I(205) Ban II(215) Sac I(215) Hind III(223) Sac II(236)

Ap (29 88 -3 84

Pvu I(3428)

5)

Drd II(675)

Bgl I(3178) Nhe I(1008) Nde I(1015) Xba I(1053) Bgl II(1111) Msc I(1136)

Eam1105 I(3058) –

pET-17xb
(4053bp)

Bsg I(1325) AlwN I(2581) Eco47 III(1419) BsmF I(1436)

o ri

(2 2 2

7)
BspG I(1691) Pvu II(1756) BsmB I(1806) Tth111 I(1910) BsaA I(1917)

BspLU11 I(2165) Afl III(2165) Sap I(2049)

Bgl II Nde I Nhe I

T7 promoter

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
T7?Tag T7 gene 10 primer #69341-3

Xba I

rbs

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGT...705bp...GAGGTTGTAGAAGTTCCGCACCTCACCGCTGGTGGTGCTGGTACCGCGGATTCAAGCTTGGTACCGAGCTCGGATCCACTAGTA MetAlaSerMetThrGlyGlyGlnGlnMetGly...235aa...GluValValGluValProHisLeuThrAlaGlyGlyAlaGlyThrAlaAspSerSerLeuValProSerSerAspProLeuVal ACGGCCGCCAGTGTGCTGGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ThrAlaAlaSerValLeuGluPheCysArgTyrProSerHisTrpArgProLeuGluGlnIleArgLeuLeuThrLysProGluArgLysLeuSerTrpLeuLeuProProLeuSerAsnAsnEnd
T7 terminator

Sac II

Hind III

Sac I BamH I Spe I

BstX I

EcoR I

EcoR V

BstX I

Not I

Xho I

Bpu1102 I

CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

T7 terminator primer #69337-3

pET-17xb cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-17xb Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsbI BscGI BsgI BsiI BsiEI BslI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 1 2 4 57 1 17 13 6 3 1 1 2 5 1 3 1 2 27 7 5 3 6 8 1 1 4 2 1 4 1 3 2 5 5 2 9 1 4 6 14 6 1 1 41 10 Locations 3980 650 1935 1674 1815 2165 2117 3357 Enzyme DpnI DraI DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoO109I EcoRI EcoRII EcoRV FauI FokI 162 3219 23 179 470 3597 72 2660 3178 1111 868 539 82 522 1917 164 3595 59 4 1881 46 2838 1325 440 150 3577 522 3895 1806 1436 713 2690 215 3729 4 1691 2165 146 3119 585 651 160 134 2817 611 3506 2256 698 504 200 2913 621 2554 2667 1742 1009 3248 854 2795 1776 1054 3095 3663 3563 1179 FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HphI KpnI MaeII MaeIII MboII MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NciI NdeI NheI NlaIII NlaIV NotI NspI P?1108I PleI Psp5II Psp1406I PstI PvuI PvuII RcaI RsaI SacI SacII SapI 2 3 4 4 14 6 3 18 9 1 1 10 12 2 14 17 8 2 26 1 16 6 19 9 25 8 1 1 17 15 1 3 2 4 2 4 2 1 1 3 8 1 1 1 # Sites 19 3 2 1 2 4 2 1 2 3 1 2 4 1 4 1 6 9 Locations 2924 1858 675 233 147 147 3058 2049 2239 1419 2713 55 174 1131 166 1095 1878 597 1851 1146 147 1136 1338 671 3584 251 210 662 3599 223 229 1719 221 2943 2273 1137 191 191 3853 2385 3725 1129 2191 1180 1384 3024 3280 191 2180 1421 1701 728 377 876 3635 Sau3AI ScaI ScrFI SfaNI SfcI SpeI SspI StyI TaqI TaqII T?I 1868 1710 ThaI TseI Tsp45I Tsp509I 3446 2191 2043 1858 2751 447 3057 588 3131 650 Enzymes that do not cut pET-17xb: A?II AgeI ApaI AvrII BaeI BclI BseRI BsmI BspMI BstEII Bsu36I ClaI FseI HpaI MluI NcoI NgoAIV NruI PacI P?MI PmeI RleAI RsrII SalI SgfI SgrAI SmaI SrfI Sse8387I StuI XcmI ApaBI BmgI BsrGI DraIII MunI NsiI PmlI SexAI SnaBI SunI 2643 2413 2276 2854 Tth111I Tth111II UbaJI VspI XbaI XhoI XmnI Enzyme Sau96I # Sites Locations 10 55 1129 3100 3179 19 1 3538 12 14 5 169 1079 1 199 1 3862 2 59 973 6 142 547 3709 6 651 2067 3761 6 229 365 2140 14 27 7 386 879 3314 3525 8 174 521 3231 3486 1 1910 5 741 1626 14 2 1094 3230 1 1053 1 141 2 1723 3657 1171 3196 1450 3418

TB048 12/98

1637 4034

1134

3446

2430

2621

3299

215 3729 1979 2581 174 141 1129 205 217 215 1283

1159 2479

1983 3725

2483

3644

3213

775 3406 631

1108 3591 1215

2265 3744 1719

1115 1171 237 4036

1171 2312 1461 1446 3205

4034 2325 1647 1524 3492

1450 3006

3196

3418

1604 1045 4051 2755

1817 1095

1912 2925

2762

2794

935 1271 714 1110 3977 233 1354 3601 1141 3059 2338 194

1692

3128

1078 1362 973 2371 1526 3083 3722 2081

3119

365 2065 241

631 2140

1086 2536

1215 3053

1137 2518 1859 3605 4029 2505

2325 3349 2492

1283 3731 2380 1136 1152 3828 86 1875 788 2545 1015 1008

2036 3840 2564

2827 4036

2898

3653

AscI BsaXI BssHII EcoNI NarI NspV PshAI S?I SphI SwaI

3428

1347

1738

3310

3469

714

1078

1806

3119

235 2507 1175 3241

253 2752 1503 3592

846 3693 1809

1756

Bsp1286I 6 BspEI BspGI BspLU11I BsrI BsrBI BsrDI BsrFI Bst1107I BstXI BstYI Cac8I CjeI CjePI CviJI CviRI DdeI 2 1 1 17 4 2 2 2 2 10 12 18 20 64 14 19

745 2836 1159 1354

978 2868 1983

1010 3962 2483

2658 3994 3644

1844

835 3293 3138 1936 186 205 2903

2098

3899

1111 2915

1357 3683

2806 3700

147 1510 669 1094 1129 292 173 3428 1756 2885 219 983 215 236 2049

1802 3076 2059 1171 1490 3303

2169 2544 3284 3047 3657

3893 239 1971

3998 536 3538

861

890

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-19b Vector

TB049 12/98 The pET-19b vector (Cat. No. 69677-3) carries an N-terminal His?Tag? sequence followed by an enterokinase site and three cloning sites. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.

pET-19b sequence landmarks

Eam1105 I(4722) –

Ap

T7 promoter T7 transcription start His?Tag coding sequence Multiple cloning sites (Nde I -BamH I) T7 terminator lacI coding sequence pBR322 origin bla coding sequence

472-488 471 366-395 319-335 213-259 875-1954 3891 4652-5509
Sca I(5202) Pvu I(5092) Pst I(4967) Bsa I(4783)

Aat II(5644) Ssp I(5526)

EcoR I(5715) Cla I(24) Hind III(29)

(4

9) 50 -5 2 65

Bpu1102 I(267) BamH I(319) Xho I(324) Nde I(331) Nco I(398) Xba I(437) Bgl II(503) SgrA I(544) Sph I(700) EcoN I(760) Drd II(948)

Mlu I(1225) Bcl I(1239) BstE II(1406) Bmg I(1434) Apa I(1436) BssH II(1636) Hpa I(1731) BsaX I(1884)

5-1 lacI (87 954)

AlwN I(4245) –

pET-19b
(5717bp)

o ri (

389

1)
PshA I(2070) Eag I(2293) Nru I(2328) BspM I(2408) Bpu10 I(2935) Bsm I(2713) Msc I(2800)

BspLU11 I(3829)

Sap I(3713) Bst1107 I(3600) Acc I(3599) BsaA I(3581) Tth111 I(3574)

T7 promoter primer #69348-3

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCCATCATCATCATCATCATCATCATCATCACAGCAGCGGCCATATCGACGACGACGACAAGCATATGCTCGAGGATCCGGCTGCTAACAAA MetGlyHisHisHisHisHisHisHisHisHisHisSerSerGlyHisIleAspAspAspAspLysHisMetLeuGluAspProAlaAlaAsnLys GCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG AlaArgLysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd
T7 terminator primer #69337-3

Bgl II

T7 promoter

lac operator

Xba I

rbs

Nco I

His?Tag

Nde I

Xho I BamH I

Bpu1102 I

Enterokinase

T7 terminator

pET-19b cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-19b Restriction Sites
Enzyme AatII AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApaI ApaBI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BclI BfaI BglI BglII BmgI BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BsgI BsiI BsiEI BslI BsmI BsmAI BsmBI BsmFI BsoFI Bsp24I Bsp1286I BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI # Sites 1 1 7 89 2 24 16 8 4 1 1 2 2 2 9 1 12 3 5 28 16 7 5 8 1 6 3 1 1 6 1 1 1 1 3 8 11 7 1 2 13 3 3 6 22 1 7 2 4 52 12 11 2 3 1 1 25 3 4 8 Locations 5644 3599 992 1720 3781 5021 1225 3829 2051 3338 3479 Enzyme BssHII Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraI DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NarI NciI NcoI NdeI NgoAIV NlaIII NlaIV NruI NspI P?1108I # Sites 1 1 1 3 11 41 26 28 1 96 26 11 29 3 2 1 3 7 1 1 3 5 3 2 1 5 1 10 2 18 14 3 6 8 13 29 15 2 44 5 2 1 14 1 17 12 18 15 1 2 34 1 24 10 35 11 44 5 14 1 1 4 31 28 1 4 2 Locations 1636 3600 1406 1027 1156 Enzyme P?MI PleI 1279 # Sites Locations 3 807 2675 7 486 774 4208 4711 PshAI 1 2070 Psp5II 2 2793 2835 Psp1406I 5 887 2255 PstI 1 4967 PvuI 1 5092 PvuII 3 1825 1918 RcaI 4 623 4549 RsaI 4 165 1372 SapI 1 3713 Sau96I 22 Sau3AI 29 ScaI 1 5202 ScrFI 24 SfaNI 24 SfcI 5 138 471 SgrAI 1 544 SphI 1 700 SspI 1 5526 StyI 3 244 398 TaqI 14 TaqII 8 1133 1351 5255 5408 T?I 7 1904 2206 3383 3804 ThaI 39 TseI 28 Tsp45I 9 124 1406 3481 3576 Tsp509I 16 Tth111I 1 3574 Tth111II 8 324 1064 4426 4458 UbaJI 24 VspI 4 486 1910 XbaI 1 437 XcmI 3 1081 1597 XhoI 1 324 XmnI 2 3387 5321 Enzymes that do not cut pET-19b: A?II AgeI AscI BseRI BsrGI Bsu36I KpnI MunI NheI NspV PacI PmeI RsrII SacI SacII S?I SgfI SmaI SrfI Sse8387I StuI 2724 861 1657

TB049 12/98

3723

3154

4948

5321

725 4147 1205 4245 1436 909 1500 324 1777 2835 319 609 1371

1209 5308 3643

2532 5393 4143

2823 5389

3647

24

3420 5557 3635

5662 5202

2406 5715 2779 2153 3114

2241 4860

2490 5082

2793

623 1710

1436 2084

2947

5700

208 4459 744 1517 3440 1239 257 4912 2289 503 1434 1063 4792 2935 267 4783 3581 502 548 2560 189 4182 1884 3545 1076 4002 2010 5241 2713 922 4783 1840 686

2039 5327 1085 1551 5227 438 2523

2209 1712 2051 5261 2843 4842

3920 2521 2085

4218 4331 3406

4324

4577

4588 3522 948 398 355 2798 2293 4722 843 1002 630 4377 760 240 5715 129 2412 187

4607 3937 662 533 5110

5299

2801 665

1899

2293

4094

4285

4963

3713 2749 2131 5389 658 948 2795 1675

5517 3903 3083

2723 2024 5425 2360 3731 2658 5070 2879

4049

4877

2793 1263 3855

2835 1803 3976

5698 1860 3989

2234 4978

2501 5189

3268

1552

2186

2740

3356

2712 355 5110 953 3844

2810 533 2274 3855

4944 665 2346 4307

1899 2403

2293 2800

1757 5714 1969 1615

3290

4419

4894

508 569 5259 1544 5013 5265 1276 5386 2296

3026 683 5641 2047

823 16 1731 29 1731

4415 1124 5263 2495 4721 4795 AvrII DraIII NotI PmlI SalI SnaBI SunI BaeI FseI NsiI RleAI SexAI SpeI SwaI

1182

1865

3018

4035

2989 5693 3745

4169

5092

1225 4044 2800 1277 3011

4228

1327 5559 3470 2227

1453

1840

3470

1565 3402

1595 4974

2385 5133

2816 5492

2452

3100

548 398 331 535

569

683

1865

2560

189 2413 3829 2408 458 1272 160 2283

3018 2490

3355

2123

2283

2637

3762 1638 535 2637

5563 4783 544 4802

4957 911

2123

2328 700 2112

3174 4740

3466

3833

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-20b(+) Vector

TB037 12/98 The pET-20b(+) vector (Cat. No. 69739-3) carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His?Tag? sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Hinc II(181) Sac I(190) EcoR I(192) BamH I(198) EcoR V(217) Nco I(220) BseR I(260) BspM I(268) Nde I(288) Xba I(326) Bgl II(384) Bpu10 I(544) Bbs I(556) Bsg I(598) Eco47 III(692) BsaH I(2868) Sca I(2811) Pvu I(2701)

Bpu1102 I(80)
pET-20b(+) sequence landmarks

T7 promoter T7 transcription start pelB coding sequence Multiple cloning sites (Nco I - Xho I) His?Tag coding sequence T7 terminator pBR322 origin bla coding sequence f1 origin

353-369 352 224-289 158-225 140-157 26-72 1500 2261-3118 3250-3705
Drd II(3479) Dra III(3474) BsaX I(3422)

f1

705) 50-3 (32 n igi or

-3118) (2261 Ap

pET-20b(+)
(3716bp)

BspG I(964) Pvu II(1029) BsmB I(1079) Tth111 I(1183) Bst1107 I(1209)

Pst I(2576)

Pfl1108 I(2349) Eam1105 I(2331)

o

15 ri (

00

)

Sap I(1322) BspLU11 I(1438) Afl III(1438)

HgiE II(2024)

AlwN I(1854)

T7 promoter primer #69348-3

Bgl II Nde I BspM I

T7 promoter

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
pelB leader

Xba I

rbs

TATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCATGGATATCGGAATTAATTCGGATCCGAATTCGAGCTCC MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeuLeuLeuAlaAlaGlnProAlaMetAlaMetAspIleGlyIleAsnSerAspProAsnSerSerSer GTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAAC ValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd
T7 terminator T7 terminator primer #69337-3

Nco I EcoR V

BamH I EcoR I Sac I

Hinc II Sal I Hind III

Eag I Not I

Xho I

His?Tag

signal peptidase

Bpu1102 I

TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-20b(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-20b(+) Restriction Sites
Enzyme AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BseRI BsgI BsiI BsiEI BslI BsmAI BsmBI BsmFI BsoFI Bsp24I Bsp1286I BspEI BspGI BspLU11I BspMI BsrI BsrBI BsrDI BsrFI Bst1107I BstYI Cac8I CjeI CjePI CviJI CviRI # Sites 2 5 49 1 18 13 7 3 1 3 2 5 1 2 2 1 26 6 5 2 6 7 2 1 2 1 1 2 2 2 1 4 5 1 2 10 1 1 2 6 12 4 1 2 38 4 8 2 1 1 1 14 3 2 3 1 10 16 10 10 57 13 Locations 180 1208 947 1088 1438 1390 2630 3314 # Sites Locations 10 80 101 1246 1713 DpnI 19 DraI 3 2197 2216 DraIII 1 3474 DrdI 3 1131 1546 DrdII 1 3479 DsaI 2 220 410 EaeI 4 166 223 EagI 1 166 Eam1105I 1 2331 EarI 2 1322 3126 EciI 3 1512 1658 Eco47III 1 692 Eco57I 2 1986 2998 EcoO109I 3 53 402 EcoRI 1 192 EcoRII 4 404 1464 EcoRV 1 217 FauI 8 368 453 1151 3611 FokI 8 657 719 2297 2478 FspI 2 419 2553 GdiII 2 166 2719 HaeI 5 225 409 HaeII 6 611 694 3633 HaeIII 14 HgaI 6 974 1131 3691 HgiEII 1 2024 HhaI 23 Hin4I 2 2330 2404 HincII 1 181 HindIII 1 173 HinfI 9 359 488 1809 2326 HphI 9 483 1058 2817 3023 MaeII 12 MaeIII 15 MboII 8 556 1309 3004 3113 MmeI 3 1653 1837 MnlI 20 MscI 2 225 409 MseI 23 MslI 6 425 620 3101 MspI 18 MspA1I 7 84 267 2025 2966 MwoI 19 NciI 7 448 776 2514 2865 NcoI 1 220 NdeI 1 288 NgoAIV 2 231 3575 NlaIII 15 NlaIV 15 NotI 1 166 NspI 3 783 1075 P?1108I 1 2349 PleI 6 367 1332 3417 Psp5II 2 402 444 Psp1406I 4 763 2557 PstI 1 2576 PvuI 1 2701 PvuII 1 1029 RcaI 2 2158 3166 Enzyme DdeI 136 2122 2908 3429 Sau3AI ScaI ScrFI SfaNI SfcI SspI StyI TaqII 444 1585 734 3680 797 2765 1598 920 983 1141 1124 T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II UbaJI VspI XbaI XhoI XmnI 3 16 26 6 11 1 4 12 3 1 1 3 19 1 11 13 5 2 7 6 544 2288 706 2828 Enzyme RsaI SacI SalI SapI Sau96I # Sites 2 1 1 1 10 Locations 1244 2811 190 179 1322 53 402 2373 2452 2811

TB037 12/98

444 2469

723 2691

910 3465

159 2917 1252 1854 192 158 402 198 2279 190 556 227 3481 21 1940 160 2870 70 2521 237 384 965 544 80 351 1190 383 2868 57 2 3422 1154 44 2111 260 598 1611 169 2850 351 1079 709 1931 159 2917 2 964 1438 268 1371 2392 231 1209 132 2090 1451 2006 1925 2136

190 3002 1752 3276 388 444 3511 3549

432 2998 3287 723

1256

1756

407

2719

2469

2691

2486

352 3135 159 2982 1340 3378 488

1703 3266 180 3507 2679 992

1894 190 2864 1413

2572 381 3017

3693 1538 3034

2368 1529 3500 194 327 3625 2451 2401

2492 1827 1015 452

2779 2068 1049 1933

3464 2936 2836 2186

877 3647 1183 899 207 326 158 208

1090

1185

2587

2798

2028 367

2035 2503

2067

1453 1316

1464 1686

1916 3625

996

2930

1549

2127

2857 Enzymes that do not cut pET-20b(+): AatII A?II AgeI ApaI AscI AvrII BaeI BclI BsmI BsrGI BssHII BstEII Bsu36I ClaI EcoNI FseI KpnI MluI MunI NarI NruI NsiI NspV PacI PmeI PmlI PshAI RleAI SacII SexAI S?I SgfI SmaI SnaBI SpeI SphI Sse8387I StuI SunI SwaI ApaBI BmgI BstXI HpaI NheI P?MI RsrII SgrAI SrfI XcmI

2392 3474 635 220 627 3381 414 2332 410 1644 1598 1791

2622

799 2356

1132 2878

1765 3568

992 3401 1067 3058

1338 3423 2174 3475

1413 2401

2995 271

1354

1778

2701

2100 3614 3451

2171

2926

1079 3689 1963 190 3002 627

2392

3168

1011

2583

2742

2109 432 3549

2141 1256

1029

1148

1780

1756

1082

1117

1818

3172 2566 2411 198 2176 1484 2036 1957 2223

3618 3575 384 2188 1925 2039 1958 2256 630 2956 1958 2103 1990 2695 2079 2973 2003 2136 2103 2728

1442 1817 2320 3409

2930

3259

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-21(+) Vector

TB063 12/98 pET-21(+) (Cat. No. 69770-3) is a transcription vector designed for expression from bacterial translation signals carried within a cloned insert. It therefore lacks the ribosome binding site and ATG start codon present on the pET translation vectors. A C-terminal His?Tag? sequence is available. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Ava I(158) Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198)

pET-21(+) sequence landmarks

Sty I(57) Bpu1102 I(80)

T7 promoter T7 transcription start Multiple cloning sites (BamH I - Xho I) His?Tag? coding sequence T7 terminator lacI coding sequence pBR322 origin bla coding sequence f1 origin

237-253 236 158-203 140-157 26-72 640-1719 3153 3914-4771 4903-5358
Dra III(5127)

f1

3-5358) (490 igin or

Bgl II(268) SgrA I(309) Sph I(465) EcoN I(525) PflM I(572) ApaB I(674)

Ap (39 1447 71 )

Sca I(4464) Pvu I(4354) Pst I(4229)

Mlu I(990) Bcl I(1004) BstE II(1171) Bmg I(1199) Apa I(1201) BssH II(1401) EcoR V(1440) Hpa I(1496)

0-1719) I (64 lac

Bsa I(4045)
Eam1105 I(3984)–

pET-21(+)
(5369bp)

AlwN I(3507)

or

PshA I(1835)

i (3

15

3)

BspLU11 I(3091) Sap I(2975) Bst1107 I(2862) Tth111 I(2836)

Psp5 II(2097) Bpu10 I(2197) BspE I(2617)

T7 promoter primer #69348-3 T7 promoter lac operator

TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCAC
Bpu1102 I

BamH I EcoR I Sac I

Sal I Hind III

Eag I Not I

Ava I* Xho I
T7 terminator

His?Tag

TGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

Sty I

pET-21(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-21(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2861 8 757 1485 3043 4283 AciI 80 A?III 2 990 3091 AluI 25 AlwI 16 Alw21I 9 159 190 2909 3409 Alw44I 4 970 2905 AlwNI 1 3507 ApaI 1 1201 ApaBI 1 674 ApoI 4 192 1265 AvaI 1 158 AvaII 7 1542 1918 4122 4344 BamHI 1 198 BanI 9 312 333 1759 1885 BanII 5 190 374 BbsI 4 1136 1475 BbvI 26 BccI 13 Bce83I 7 21 1804 3721 4589 BcefI 5 509 850 BcgI 10 160 194 1850 2668 BclI 1 1004 BfaI 7 70 203 4174 5278 BglI 2 2054 4104 BglII 1 268 BmgI 1 1199 BpmI 5 828 1317 Bpu10I 1 2197 Bpu1102I 1 80 BsaI 1 4045 BsaAI 2 2843 5127 BsaBI 3 267 273 BsaHI 6 313 334 4521 BsaJI 6 57 427 3251 BsaWI 7 2 1309 3444 4275 BsaXI 2 1649 5075 BsbI 2 2807 5034 BscGI 13 BsgI 3 841 1041 BsiI 2 3264 4648 BsiEI 6 169 1775 4503 BslI 20 BsmAI 7 687 1092 4045 4821 BsmBI 2 1605 2732 BsmFI 4 451 1992 BsoFI 46 Bsp24I 10 280 312 1165 3584 Bsp1286I 13 BspEI 2 2 2280 BspGI 1 2617 BspLU11I 1 3091 BsrI 25 BsrBI 4 223 3024 BsrDI 4 1037 1403 BsrFI 7 300 309 4064 5228 BssHII 1 1401 1816 4967 2600 2741 Enzyme Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI CviJI CviRI DdeI DpnI DraI DraIII DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I MwoI NarI NciI NgoAIV NlaIII NlaIV NotI NspI P?1108I P?MI PleI PshAI Psp5II # Sites 1 1 3 12 38 24 18 85 24 11 27 3 1 3 2 2 5 1 1 3 4 3 2 1 3 1 7 1 17 10 2 5 5 14 24 12 2 45 3 2 1 14 1 16 15 18 14 1 3 26 26 9 31 9 38 4 12 4 24 25 1 4 2 1 9 1 1 Locations 2862 1171 792 921 1044 Enzyme # Sites Locations Psp1406I 6 652 2020 4912 PstI 1 4229 PvuI 1 4354 PvuII 3 1590 1683 RcaI 3 388 3811 RsaI 3 1137 2897 SacI 1 190 SalI 1 179 SapI 1 2975 Sau96I 18 Sau3AI 27 ScaI 1 4464 ScrFI 19 SfaNI 20 SfcI 5 236 3356 SgrAI 1 309 SphI 1 465 SspI 2 4788 4919 StyI 1 57 TaqI 13 TaqII 9 898 1116 4517 4670 T?I 5 1669 1971 ThaI 34 TseI 26 Tsp45I 8 1171 1999 4240 4451 Tsp509I 15 Tth111I 1 2836 Tth111II 6 829 1522 3720 UbaJI 20 VspI 4 251 1675 XcmI 3 846 1362 XhoI 1 158 XmnI 2 2649 4583 Enzymes that do not cut pET-21(+): AatII A?II AgeI BaeI BseRI BsmI Bsu36I ClaI FseI MunI NcoI NdeI NsiI NspV PacI RleAI RsrII SacII SgfI SmaI SnaBI Sse8387I StuI SunI 2416 4210

TB063 12/98

4583

2682 4819 4464

490 4570 3405

974 4655 4651

2085

4929 2006

4940 2097 2376

447 3932 388 1849

910 5164 1201 2209

1629 5202

1974 1477 1282 2702 2105

3182 3593 1316 4489 3586

3480 5153 1816 4523 3839

3850 5127 2784 713 427 166 166 3984 608 767 395 3639 525 53 192 713 3238 1440 1036 2636 2072 166 718

3869 3199 5132 2063 298

4561 5082

3547

4225

5346

430

1664

4372

2975 3165 1896 4651 423 1028 3251

4779 3311 2345

4139

1789 4687 2141

2993 5031 2645

4332 3066

2097 1568 1625 3117

2530 5300

2743

2838

1045 2777 4206 298 2039

2310 3950 430 3106

2372 4131 1664 3117

2450 4418 4372 3569

2552

3681

3688

1734 1380

4156

1951

2618

4054

588 889 181 173 1496

3677 3983 1496 4057

2288 448 433 1812

947 1625 2280

1630 2063 3297

AscI BspMI KpnI NheI PmeI SexAI SpeI SwaI

AvrII BsrGI MscI NruI PmlI S?I SrfI XbaI

2251 3007 3431 4354

990 3306

3490

5104

1042 2664 84 2801 313 300

1330 4236 1020 3433 334 1888

1360 4395 1590 3678 448 2048

2078 4754 1683 4619 1630 5228

2273

1218

1605

2732

2682

2362 831 3616

5342 863 3762 1133 3794

4825 4045 676

5271 4219 1888

2048

166 465 1877 572 251 3470 1835 2097

2436 4002 539 3973

2728

3095

626 5062

1422 5070

2985

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-21a-d(+) Vectors
pET-21a DNA pET-21b DNA pET-21c DNA pET-21d DNA Cat. No. 69740-3 69741-3 69742-3 69743-3

TB036 12/98 The pET-21a-d(+) vectors carry an N-terminal T7?Tag? sequence plus an optional C-terminal His?Tag? sequence. These vectors differ from pET-24a-d(+) only by their selectable marker (ampicillin vs. kanamycin resistance). Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Ava I(158) Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) Nhe I(231) Nde I(238) Xba I(276) Bgl II(342) SgrA I(383) Sph I(539) EcoN I(599) PflM I(646) ApaB I(748)

pET-21a(+) sequence landmarks

T7 promoter T7 transcription start T7?Tag coding sequence Multiple cloning sites (BamH I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin bla coding sequence f1 origin

311-327 310 207-239 158-203 140-157 26-72 714-1793 3227 3988-4845 4977-5432
Dra III(5201)

Sty I(57) Bpu1102 I(80)

5432) 4977in ( rig o f1
Sca I(4538)

Pvu I(4428) The maps for pET-21b(+), pET-21c(+) and pET-21d(+) are the same as pET-21a(+) Pst I(4303) (shown) with the following exceptions: pET-21b(+) is a 5442bp plasmid; subtract 1bp from each site beyond BamH I at 198. Bsa I(4119) pET-21c(+) is a 5441bp plasmid; subtract Eam1105 I(4058) – 2bp from each site beyond BamH I at 198. pET-21d(+) is a 5440bp plasmid; the BamH I site is in the same reading frame as in pET21c(+). An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 238 of pET-21c(+). As a result, Nco I cuts AlwN I(3581) or pET21d(+) at 234, and Nhe I cuts at 229. For i( 32 the rest of the sites, subtract 3bp from each 27 ) site beyond position 239 in pET-21a(+). Nde I does not cut pET-21d(+). Note also BspLU11 I(3165) that Sty I is not unique in pET-21d(+). Sap I(3049) Bst1107 I(2936) Tth111 I(2910)

Ap (39 8848 45 )

Mlu I(1064) Bcl I(1078) BstE II(1245) Bmg I(1273) Apa I(1275) BssHII(1475) EcoR V(1514) Hpa I(1570)

(714-1793) lacI

pET-21a(+)
(5443bp)

PshA I(1909) PpuM I(2171) Psp5 II(2171) Bpu10 I(2271) BspG I(2691)

T7 promoter primer #69348-3

Bgl II

T7 promoter

lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I Nhe I
T7?Tag

Xba I

rbs

pET-21a

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeu pET-21d pET-21b pET-21c,d
Nco I

BamH I EcoR I Sac I

Sal I Hind III

Eag I Not I

Ava I Xho I

His?Tag

...GGTCGGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd ...GGTCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGlu
Bpu1102 I
T7 terminator

...TACCATGGCTAGC... MetAlaSer...

GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-21a-d(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-21a(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2935 8 831 1559 3117 4357 AciI 81 A?III 2 1064 3165 AluI 25 AlwI 16 Alw21I 9 159 190 2983 3483 Alw44I 4 1044 2979 AlwNI 1 3581 ApaI 1 1275 ApaBI 1 748 ApoI 4 192 1339 AvaI 1 158 AvaII 7 1616 1992 4196 4418 BamHI 1 198 BanI 9 386 407 1833 1959 BanII 5 190 448 BbsI 4 1210 1549 BbvI 26 BccI 21 Bce83I 7 21 1878 3795 4663 BcefI 5 583 924 BcgI 11 BclI 1 1078 BfaI 8 70 232 3913 4248 BglI 2 2128 4178 BglII 1 342 BmgI 1 1273 BpmI 5 902 1391 Bpu10I 1 2271 Bpu1102I 1 80 BsaI 1 4119 BsaAI 2 2917 5201 BsaBI 3 341 347 BsaHI 6 387 408 4595 BsaJI 6 57 501 3325 BsaWI 7 2 1383 3518 4349 BsaXI 2 1723 5149 BsbI 2 2881 5108 BscGI 13 BsgI 3 915 1115 BsiI 2 3338 4722 BsiEI 6 169 1849 4577 BslI 20 BsmAI 7 761 1166 4119 4895 BsmBI 2 1679 2806 BsmFI 4 525 2066 BsoFI 46 Bsp24I 12 Bsp1286I 13 BspEI 2 2 2354 BspGI 1 2691 BspLU11I 1 3165 BsrI 26 BsrBI 4 297 3098 BsrDI 4 1111 1477 BsrFI 7 374 383 4138 5302 BssHII 1 1475 Bst1107I 1 2936 BstEII 1 1245 1890 5041 2674 2815 Enzyme BstXI BstYI Cac8I CjeI CjePI CviJI CviRI DdeI DpnI DraI DraIII DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I MwoI NarI NciI NdeI NgoAIV NheI NlaIII NlaIV NotI NspI P?1108I P?MI PleI PshAI Psp5II # Sites 3 12 39 26 20 86 24 11 27 3 1 3 2 2 5 1 1 3 4 3 2 1 3 1 7 1 17 10 2 5 5 14 24 12 2 45 3 2 1 14 1 16 15 18 14 1 3 26 28 9 31 9 38 4 12 1 4 1 25 25 1 4 2 1 9 1 1 Locations 866 995 1118 Enzyme # Sites Locations Psp1406I 6 726 2094 4986 PstI 1 4303 PvuI 1 4428 PvuII 3 1664 1757 RcaI 3 462 3885 RsaI 3 1211 2971 SacI 1 190 SalI 1 179 SapI 1 3049 Sau96I 18 Sau3AI 27 ScaI 1 4538 ScrFI 19 SfaNI 20 SfcI 5 310 3430 SgrAI 1 383 SphI 1 539 SspI 2 4862 4993 StyI 1 57 TaqI 13 TaqII 9 972 1190 4591 4744 T?I 5 1743 2045 ThaI 35 TseI 26 Tsp45I 8 1245 2073 4314 4525 Tsp509I 16 Tth111I 1 2910 Tth111II 6 903 1596 3794 UbaJI 20 VspI 4 325 1749 XbaI 1 276 XcmI 3 920 1436 XhoI 1 158 XmnI 2 2723 4657 2490 4284

TB036 12/98

4657

2756 4893 4538

564 4644 3479

1048 4729 4725

2159

5003 2080

5014 2171 2450

521 4006 462 1923

984 5238 1275 2283

1703 5276

2048 1551

3256 3667

3554 5227

3924 5201 2858 787 501 166 166 4058 682 841 469 3713 599 53 192 787 3312 1514 1110 2710 2146 166 792

3943 3273 5206 2137 372

4635 5156

504

1738

4446

3621

4299

5420

3049 3239 1970 4725 497 1102 3325

4853 3385 2419

4213

2171 1642 1699 3191

1863 4761 2215

3067 5105 2719

4406 3140

2604 5374

2817

2912

277 5352

2179

3660

1119 2851 4280 372 2113

2384 4024 504 3180

2446 4205 1738 3191

2524 4492 4446 3643

2626

3755

3762

1808 1454

4230

2025

2692

4128

662 963 181 173 1570

3751 4057 1570 4131

2362 522 507 1886

1021 1699 2354

1704 2137 3371

1064 3380

Enzymes that do not cut pET-21a(+): AatII A?II AgeI AscI BaeI BseRI BsmI BspMI Bsu36I ClaI FseI KpnI MunI NcoI NruI NsiI PacI PmeI PmlI RleAI SacII SexAI S?I SgfI SnaBI SpeI SrfI Sse8387I SunI SwaI 5178

AvrII BsrGI MscI NspV RsrII SmaI StuI

3564

2325 3081 3505 4428

1116 2738 84 2875 387 238 374 231

1404 4310 1094 3507 408

1434 4469 1664 3752 522

2152 4828 1757 4693 1704

2347

1292

1679

2806

2756

2436

5416

1962

2122

5302

4899 4119 750

5345 4293 1962

2122

166 539 1951 646 325 3544 1909 2171

2510 4076 613 4047

2802

3169

700 5136

1496 5144

3059

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-22b(+) Vector

TB038 12/98 The pET-22b(+) vector (Cat. No. 69744-3) carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His?Tag? sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Ava I(158) Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) Nco I(220) Msc I(225) BseR I(260) BspM I(268) Nde I(288) Xba I(326) Bgl II(392) SgrA I(433) Sph I(589) PflM I(696) ApaB I(798)

pET-22b(+) sequence landmarks

Bpu1102 I(80)

T7 promoter T7 transcription start pelB coding sequence Multiple cloning sites (Nco I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin bla coding sequence f1 origin

361-377 360 224-289 158-225 140-157 26-72 764-1843 3277 4038-4895 5027-5482
Dra III(5251)

5482) 5027in ( rig o f1
Ap (4 038 -48 95 )
Sca I(4588) Pvu I(4478) Pst I(4353)

Mlu I(1114) Bcl I(1128) BstE II(1295) Bmg I(1323) Apa I(1325) BssH II(1525) Hpa I(1620)

(764-1843) lacI

Bsa I(4169)
Eam1105 I(4108) –

pET-22b(+)
(5493bp)

AlwN I(3631)

or

i(

32

PshA I(1959)

77

)
Psp5 II(2221) Bpu10 I(2321) BspG I(2741)

BspLU11 I(3215) Sap I(3099) Bst1107 I(2986) Tth111 I(2960)

T7 promoter primer #69348-3

Bgl II Nde I BspM I

T7 promoter pelB leader

lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Msc I Nco I

Xba I

rbs

TATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCATGGATATCGGAATTAATTCGGATCCGAATTCGAGCTCC MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeuLeuLeuAlaAlaGlnProAlaMetAlaMetAspIleGlyIleAsnSerAspProAsnSerSerSer GTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAAC ValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd
T7 terminator T7 terminator primer #69337-3

BamH I EcoR I Sac I

Sal I

Hind III

Eag I Not I

Ava I* Xho I

signal peptidase His?Tag

Bpu1102 I

TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-22b(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-22b(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2985 8 881 1609 3167 4407 AciI 81 A?III 2 1114 3215 AluI 25 AlwI 16 Alw21I 9 159 190 3033 3533 Alw44I 4 1094 3029 AlwNI 1 3631 ApaI 1 1325 ApaBI 1 798 ApoI 4 192 1389 AvaI 1 158 AvaII 7 1666 2042 4246 4468 BamHI 1 198 BanI 9 436 457 1883 2009 BanII 5 190 498 BbsI 4 1260 1599 BbvI 31 BccI 14 Bce83I 7 21 1928 3845 4713 BcefI 5 633 974 BcgI 10 160 194 1974 2792 BclI 1 1128 BfaI 7 70 327 4298 5402 BglI 3 237 2178 BglII 1 392 BmgI 1 1323 BpmI 5 952 1441 Bpu10I 1 2321 Bpu1102I 1 80 BsaI 1 4169 BsaAI 2 2967 5251 BsaBI 3 391 397 BsaHI 6 437 458 4645 BsaJI 7 57 220 2187 3375 BsaWI 7 2 1433 3568 4399 BsaXI 2 1773 5199 BsbI 2 2931 5158 BscGI 13 BseRI 1 260 BsgI 3 965 1165 BsiI 2 3388 4772 BsiEI 7 169 271 4478 4627 BslI 20 BsmAI 7 811 1216 4169 4945 BsmBI 2 1729 2856 BsmFI 4 575 2116 BsoFI 51 Bsp24I 10 404 436 1289 3708 Bsp1286I 13 BspEI 2 2 2404 BspGI 1 2741 BspLU11I 1 3215 BspMI 1 268 BsrI 25 BsrBI 4 347 3148 BsrDI 4 1161 1527 1940 5091 2724 2865 # Sites Locations 8 231 424 2172 4188 BssHII 1 1525 Bst1107I 1 2986 BstEII 1 1295 BstXI 3 916 1045 BstYI 12 Cac8I 39 CjeI 24 CjePI 18 CviJI 87 CviRI 24 DdeI 11 DpnI 27 DraI 3 3974 3993 DraIII 1 5251 DrdI 3 2908 3323 DrdII 2 837 5256 DsaI 3 220 551 EaeI 6 166 223 4496 EagI 1 166 Eam1105I 1 4108 EarI 3 732 3099 EciI 4 891 3289 Eco47III 3 519 2020 Eco57I 2 3763 4775 EcoNI 1 649 EcoO109I 3 53 547 EcoRI 1 192 EcoRII 7 837 1152 3362 3375 EcoRV 2 217 1564 FauI 17 FokI 10 1160 1169 2760 2901 FspI 2 2196 4330 GdiII 5 166 422 HaeI 6 225 842 3693 HaeII 14 HaeIII 25 HgaI 12 HgiEII 2 712 3801 HhaI 45 Hin4I 3 1013 4107 HincII 2 181 1620 HindIII 1 173 HinfI 14 HpaI 1 1620 HphI 16 MaeII 15 MaeIII 18 MboII 14 MluI 1 1114 MmeI 3 3430 3614 MnlI 27 MscI 1 225 MseI 29 MslI 9 1166 1454 2788 4360 MspI 32 MspA1I 10 84 267 2806 2925 MwoI 39 NarI 4 437 458 NciI 12 NcoI 1 220 NdeI 1 288 NgoAIV 5 231 424 NlaIII 25 NlaIV 25 Enzyme BsrFI 433 5352 800 2012 Enzyme NotI NspI P?1108I P?MI PleI # Sites 1 4 2 1 9 Locations 166 589 2560 2001 4126 696 375 663 3594 4097 1959 2221 776 2144 5036 4353 4478 1714 1807 512 3935 1261 3021 190 179 3099 2852 3219

TB038 12/98

1168 PshAI 1 Psp5II 1 Psp1406I 6 PstI PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II UbaJI VspI XbaI XcmI XhoI XmnI 1 1 3 3 3 1 1 1 18 27 1 19 20 5 1 1 2 2 13 9 5 34 31 8 18 1 6 20 5 1 3 1 3

750 5186

1546 5194

3109

614 4694 3529

1098 4779 4775

2209

2540

4334

4707

5053 2130

5064 2221 2500

4685 5206 2187 422

2806 4943 4588

571 4056 512 1973

1034 5288 1325 2333

1753 5326

554

1788

4588

2098 1601 1406 2826 2229 4228

3306 3717 1440 4613 3710

3604 5277 1940 4647 3963

4903 3435 2469

4263

360 433 589 4912 57 1022 4641 1793

3480

3671

4349

5470

5043 220 1240 4794 2095 1913 4811 2265 3117 5155 2769 4456 3190

2221 1692 1749 3241

2075

2742

4178

2434 4074 554 2163

2496 4255 1788 3230

2574 4542 4496 3241

1295 4364 2960 953 3844 207 326 970 158 208

2123 4575

2654 5424

2867

2962

1646

2676

3805

3812

2412 572 551 1936

1071 557 2404

1754 1749 3421

375 1486 2773

1799 1504 4707

1858

4280

4181

2375 1899 3131 3555

Enzymes that do not cut pET-22b(+): AatII A?II AgeI AscI BaeI BsmI BsrGI Bsu36I FseI KpnI MunI NheI NsiI NspV PacI PmeI RleAI RsrII SacII SexAI SgfI SmaI SnaBI SpeI Sse8387I StuI SunI SwaI 5228

AvrII ClaI NruI PmlI S?I SrfI

1342

1729

2856

2486 955 3740

5466 987 3886 1257 3918

1484 4519 1144 3557 572

2202 4878 1714 3802 1754

2397

1807 4743

4949 4169

5395 4343

2012

2172

5352

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-23(+) Vector

TB064 12/98 pET-23(+) (Cat. No. 69771-3) is a transcription vector designed for expression from bacterial translation signals carried within a cloned insert. It therefore lacks the ribosome binding site and ATG start codon present on the pET translation vectors. A C-terminal His?Tag? sequence is available. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Hinc II(181) Sac I(190) EcoR I(192) BamH I(198) Bgl II(260) Msc I(285) Dsa I(286) Bpu10 I(420) Bbs I(432) Bsg I(474) Eco47 III(568)

Bpu1102 I(80)
pET-23(+) sequence landmarks

T7 promoter T7 transcription start Multiple cloning sites (BamH I - Xho I) His?Tag coding sequence T7 terminator pBR322 origin bla coding sequence f1 origin

229-245 228 158-203 140-157 26-72 1376 2137-2994 3126-3581
NgoA IV(3451) Drd II(3355) Dra III(3350) BsaX I(3298)

f1

581) 26-3 (31 n igi or

BsaH I(2744)

BspG I(840)

A p ( 2 1 3 7-

Sca I(2687) Pvu I(2577)

pET-23(+)
(3592bp)

Pvu II(905) BsmB I(955) Tth111 I(1059) Bst1107 I(1085) Sap I(1198) BspLU11 I(1314) Afl III(1314)

299

4)

Pst I(2452)

Bgl I(2327) Eam1105 I(2207)

or

i

3 (1

HgiE II(1900)

AlwN I(1730)

T7 promoter primer #69348-3 T7 promoter

TAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

BamH I EcoR I Sac I Bpu1102 I

Hinc II Sal I Hind III

Eag I Not I

Xho I

His?Tag

Sty I

T7 terminator

pET-23(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

76

)

pET-23(+) Restriction Sites
Enzyme AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BsgI BsiI BsiEI BslI BsmAI BsmBI BsmFI BsoFI Bsp24I Bsp1286I BspEI BspGI BspLU11I BsrI BsrBI BsrDI BsrFI Bst1107I BstYI Cac8I CjeI CjePI CviJI CviRI DdeI DpnI DraI # Sites 2 5 48 1 18 13 7 3 1 3 2 5 1 2 2 1 21 5 5 2 6 7 1 1 2 1 1 2 2 2 1 3 5 1 2 10 1 2 5 12 4 1 2 33 4 8 2 1 1 14 3 2 2 1 10 15 10 10 55 13 10 19 3 Locations 180 1084 823 964 1314 1266 2506 3190 Enzyme DraIII DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoO109I EcoRI EcoRII FauI FokI 2368 1405 3376 194 203 3501 2655 1703 891 328 3340 1944 925 1809 3357 2812 2712 2062 FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HphI 286 503 3257 290 2208 2871 1230 955 3565 1839 190 2878 503 1985 308 3425 2017 1132 1474 1520 1667 2498 MaeII MaeIII MboII MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NciI NgoAIV NlaIII NlaIV NotI NspI P?1108I PleI 506 2832 1834 1979 1866 2571 1955 2849 1879 2012 1979 2604 Psp5II Psp1406I PstI PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI # Sites 1 3 1 1 3 1 1 2 3 1 2 3 1 4 8 8 2 2 4 6 13 6 1 23 2 1 1 9 9 12 15 8 3 19 1 20 6 17 6 18 7 1 14 15 1 3 1 6 2 4 1 1 1 2 2 1 1 1 10 19 Locations 3350 1007 1422 3355 286 166 283 166 2207 1198 3002 1388 1534 568 1862 2874 53 278 192 280 1340 244 329 1027 3487 533 595 2173 2354 295 2429 166 2595 285 1329 487 570 3509 850 3567 1900 2206 181 173 235 1685 359 2693 1007 3305 Enzyme ScaI ScrFI SfaNI SfcI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I 1017 Tsp509I 859 1000 Tth111I Tth111II UbaJI VspI XhoI XmnI 1 4 12 2 1 2 8 # Sites 1 11 13 5 2 1 7 6 3 16 21 6 Locations 2687

TB064 12/98

2595

159 2793 1128 1730 192 158 278 198 2155 190 432 2244 21 1816 160 2746 70 2397 2327 260 841 420 80 227 1066 259 2744 57 2 3298 1030 44 1987 474 1487 169 227 955 585 1807 159 2793 2 840 1314 1247 2268 2287 1085 132 1966 1327 1882 1801 2012

190 2878 1628 3152 264 320 3387 3425

308 2874 3163 599

1132

1632

2362

228 3011 57 159 2858 1216 3254 364

1579 3142 180 3383 2555 868

1770

2448

3569

190 2740 1289

257 2893

1414 2910

320 1461 610 3556 673 2641 1474 796

2345

2567

753 3523 192 3126 1059 775 243 158 872

966 244 3152 1904 2379 2806

1061 2074 3163 1911

2463 2380

2674 2635

1943

1340 1192

1792 1562

3501

1425

2003

2733

2277

2280

2268 3350 511

364 2202 934 2899

868 3277 943 2934

1214 3299 2050 3351

1289 2277

Enzymes that do not cut pET-23(+): AatII A?II AgeI AscI AvrII BaeI BseRI BsmI BspMI BstEII BstXI Bsu36I EcoRV FseI HpaI MunI NarI NcoI NruI NsiI NspV PmeI PmlI PshAI SacII SexAI S?I SmaI SnaBI SpeI Sse8387I StuI SunI XcmI

ApaI BclI BsrGI ClaI KpnI NdeI PacI RleAI SgfI SphI SwaI

ApaBI BmgI BssHII EcoNI MluI NheI P?MI RsrII SgrAI SrfI XbaI

675 2232

1008 2754

1641 3444

432 2880 1529 285 301 2977 84 2842 324 2390 3451

1185 2989 1713

1976 3490 3327

2047

2802

1654 2268

2577 3044

2726

496

887

2459

2618

905

1024

1656

1901

1632

652 2741

958

993

1694

3048 2442 3451 198 2052 1360 1912 1833 2099

3494

260 2064 1801 1915 1834 2132

80 1122 2073

101 1589 2092

136 1998 2784

420 2164

582 2704

166 659 2225 243 3293 278 639 2452 2577 905 2034 1120 190 179 1198 53 2249

951 1208 320 2433

1318 1693 2196 3285

2806

3135

3042 2687

278 2328

320 2345

599 2567

786 3341

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-23a-d(+) Vectors
pET-23a DNA pET-23b DNA pET-23c DNA pET-23d DNA Cat. No. 69745-3 69746-3 69747-3 69748-3

TB051 12/98 The pET-23a-d(+) vectors carry an N-terminal T7?Tag? sequence plus an optional C-terminal His?Tag? sequence. These vectors differ from pET-21a-d(+) by the “plain” T7 promoter instead of the T7lac promoter and by the absence of the lacI gene. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-23a(+) sequence landmarks

T7 promoter T7 transcription start T7?Tag coding sequence Multiple cloning sites (BamH I - Xho I) His?Tag coding sequence T7 terminator pBR322 origin bla coding sequence f1 origin

303-319 302 207-239 158-203 140-157 26-72 1450 2211-3068 3200-3655
Sty I(57) Bpu1102 I(80)

NgoA IV(3525) Drd I(3429) Dra III(3424)

The maps for pET-23b(+), pET-23c(+) and pET-23d(+) are the same as pET-23a(+) (shown) with the following exceptions: pET-23b(+) is a 3665bp plasmid; subtract 1bp from each site beyond BamH I at 198. pET-23c(+) is a 3664bp plasmid; subtract 2bp from each site beyond BamH I at 198. pET-23d(+) is a 3663bp plasmid; the BamH I site is in the same reading frame as in pET23c(+). An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 238 of pET-23c(+). As a result, Nco I cuts pET-23d(+) at 234, and Nhe I cuts at 229. For the rest of the sites, subtract 3bp from each site beyond position 239 in pET-23a(+). Nde I does not cut pET-23d(+). Note also that Sty I is not unique in pET-23d(+).

f1

655) 00-3 (32 n igi or

Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Hinc II(181) Sac I(190) EcoR I(192) BamH I(198) Nhe I(231) Nde I(238) Xba I(276) Bgl II(334) Msc I(359) Dsa I(360) Bpu10 I(494) Bbs I(506) Bsg I(548) Eco47 III(642)

BsaH I(2818) Sca I(2761)

pET-23a(+)
(3666bp)
Pvu II(979)

Ap (22

Pvu I(2651)

1 1(1

Pst I(2526)

Bgl I(2401) Ahd I(2281)

or

i

45

0)

Tth111 I(1133) Bst1107 I(1159) Sap I(1272)

30

68

)
AlwN I(1804)

Afl III(1388) BspLU11 I(1388)

T7 promoter primer #69348-3

Bgl II

T7 promoter

Xba I

rbs

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I Nhe I
T7?Tag

pET-23a

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeu pET-23d pET-23b pET-23c,d
Nco I

BamH I EcoR I Sac I

Hinc II Sal I Hind III

Eag I Not I

Xho I

His?Tag

...GGTCGGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd ...GGTCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGlu
Bpu1102 I
T7 terminator

...TACCATGGCTAGC... MetAlaSer...

GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-23a-d(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-23a(+) Restriction Sites
Enzyme AccI AceIII AciI A?III AluI AlwI Alw21I Alw44I AlwNI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BsgI BsiI BsiEI BslI BsmAI BsmBI BsmFI BsoFI Bsp24I # Sites 2 5 49 1 18 13 7 3 1 3 2 5 1 2 2 1 21 5 5 2 7 8 1 1 2 1 1 2 2 2 1 3 5 1 2 10 1 2 5 12 4 1 2 33 6 Locations 180 1158 897 1038 1388 1340 2580 3264 Enzyme DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoO109I EcoRI EcoRII FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HphI 1548 1594 MaeII MaeIII MboII MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NciI NdeI NgoAIV NheI NlaIII NlaIV NotI NspI P?1108I PleI Psp5II Psp1406I PstI PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I # Sites 3 1 1 3 1 1 2 3 1 2 3 1 4 8 8 2 2 4 6 13 6 1 23 2 1 1 9 9 12 15 8 3 19 1 22 6 17 6 18 7 1 1 1 15 15 1 3 1 6 2 4 1 1 1 2 2 1 1 1 10 Locations 1081 1496 3429 360 166 357 166 2281 1272 3076 1462 1608 642 1936 2948 53 352 192 354 1414 318 403 1101 3561 607 669 2247 2428 369 2503 166 2669 359 1403 561 644 3583 924 3641 1974 2280 181 173 309 1759 433 2767 1081 3379 Enzyme Sau3AI ScaI ScrFI SfaNI SfcI SspI StyI TaqI TaqII 394 1535 684 3630 747 2715 1548 870 933 T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II UbaJI VspI XbaI XhoI XmnI 3 17 21 6 9 1 4 12 2 1 1 2 # Sites 19 1 11 13 5 2 1 7 6 Locations 2761

TB051 12/98

2669

159 2867 1202 1804 192 158 352 198 2229 190 506 2318 21 1890 160 2786 70 2136 2401 334 915 494 80 301 1140 333 2818 57 2 3372 1104 44 2061 548 1561 169 301 1029 659 201 2091 159 2867 2 914 1388 1321 2342 2361 1159 132 2040

190 2952 1702 3226 338 394 3461 3499

382 2948 3237 673

1206

1706

2436

302 3085 57 159 2932 1290 3328 438

1653 3216 180 3457 2629 942

1844

2522

3643

190 2814 1363

331 2967

1488 2984

2419

2641

1091 1074

2442 1479 3450 194 2820 232 2471

2729 1777 228 277 3575

3414 2018 965 402

3431 2886 999 1883

1414 1266

1866 1636

827 3597 192 2709 1133 849 317 276 158 946

1040 268 3200 1978 2453

1135 318 3226 1985

2537 2148 3237 2017

2748 2454

3575

1499

2077

2807

2880

2351

2354

2342 3424 585 360 577 3331 364 2282 2945 1304 1029 3639 233 190 2952 577 1881 382 3499 1913 1206 2059 1706

438 2276 1008 2973

942 3351 1017 3008

1288 3373 2124 3425

1363 2351

1741

2572

749 2306

1082 2828

1715 3518

506 2954 1603 359 375 3051 84 2916 398 2464 238 3525 231

1259 3063 1787

2050 3564 3401

2121

2876

Enzymes that do not cut pET-23a(+): AatII A?II AgeI ApaI AscI AvrII BaeI BclI BseRI BsmI BspMI BsrGI BstEII BstXI Bsu36I ClaI EcoRV FseI HpaI KpnI MunI NarI NcoI NruI NspV PacI P?MI PmeI PshAI RleAI RsrII SacII S?I SgfI SgrAI SmaI SpeI SphI SrfI Sse8387I SunI SwaI XcmI

ApaBI BmgI BssHII EcoNI MluI NsiI PmlI SexAI SnaBI StuI

1728 2342

2651 3118

2800

570

961

2533

2692

979

1098

1730

1975

726 2815

1032

1067

1768

Bsp1286I 8 BspEI BspGI BspLU11I BsrI BsrBI BsrDI BsrFI Bst1107I BstYI Cac8I CjeI CjePI CviJI CviRI DdeI DpnI DraI DraIII 2 1 1 15 3 2 2 1 10 16 12 12 56 13 10 19 3 1

3122 2516 3525 198 2126

3568

334 2138

580 2906

2029 2923

80 1196 2147 3424

101 1663 2166

136 2072 2858

494 2238

656 2778

166 733 2299 317 3367 352 713 2526 2651 979 2108 1194 190 179 1272 53 2323

1025 1282 394 2507

1392 1767 2270 3359

2880

3209

3116 2761

352 2402

394 2419

673 2641

860 3415

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-24(+) Vector

TB072 12/98 pET-24(+) (Cat. No. 69772-3) is a transcription vector designed for expression from bacterial translation signals carried within a cloned insert. It therefore lacks the ribosome binding site and ATG start codon present on the pET translation vectors. A C-terminal His?Tag? sequence is available. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Sty I(57) Bpu1102 I(80) Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198)

pET-24(+) sequence landmarks

T7 promoter T7 transcription start Multiple cloning sites (BamH I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

237-253 236 158-203 140-157 26-72 640-1719 3153 3862-4674 4770-5225
Pvu I(4293) Sgf I(4293) Sma I(4167)

Dra III(4994)

-5225) 4770 in ( rig o f1
kan (3 862 -46 74 )

Bgl II(268) SgrA I(309) Sph I(465) ApaB I(674)

Mlu I(990) Bcl I(1004)

(640-1719) lacI

Cla I(3984) Nru I(3950)

BstE II(1171) Bmg I(1199) Apa I(1201) BssH II(1401) EcoR V(1440) Hpa I(1496)

pET-24(+)
(5236bp)

Eco57 I(3639) AlwN I(3507)

ri

(3

15

Bsi I(3264)

3)

PshA I(1835) Pfl1108 I(1877) Bgl I(2054) Fsp I(2072) Psp5 II(2097) BspG I(2617)

BspLU11 I(3091) Sap I(2975) Bst1107 I(2862) Tth111 I(2836)

o

T7 promoter primer #69348-3 T7 promoter lac operator

TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCAC
Bpu1102 I

BamH I EcoR I Sac I

Sal I Hind III

Eag I Not I

Ava I* Xho I
T7 terminator

His?Tag

TGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

Sty I

pET-24(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-24(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2861 7 757 1485 3043 4834 AciI 73 A?III 2 990 3091 AluI 22 AlwI 13 Alw21I 7 159 190 2909 3409 Alw44I 3 970 2905 AlwNI 1 3507 ApaI 1 1201 ApaBI 1 674 ApoI 6 192 1265 4807 AvaI 2 158 4165 AvaII 5 1542 1918 BamHI 1 198 BanI 8 312 333 1759 1885 BanII 6 190 374 5069 BbsI 4 1136 1475 BbvI 23 BccI 13 Bce83I 6 21 1804 3721 BcefI 6 509 850 5020 BcgI 8 160 194 1850 2668 BclI 1 1004 BfaI 6 70 203 5145 BglI 1 2054 BglII 1 268 BmgI 1 1199 BpmI 4 828 1317 Bpu10I 2 2197 4310 Bpu1102I 1 80 BsaAI 2 2843 4994 BsaBI 3 267 273 BsaHI 5 313 334 BsaJI 9 57 427 3251 4164 BsaWI 7 2 1309 3444 4428 BsaXI 2 1649 4942 BsbI 2 2807 4901 BscGI 11 BsgI 3 841 1041 BsiI 1 3264 BsiEI 5 169 1775 BslI 23 BsmI 2 4177 4254 BsmAI 6 687 1092 4309 BsmBI 3 1605 2732 BsmFI 4 451 1992 BsoFI 41 Bsp24I 10 280 312 1165 3584 Bsp1286I 12 BspEI 2 2 2280 BspGI 1 2617 BspLU11I 1 3091 BsrI 21 BsrBI 4 223 3024 BsrDI 2 1037 1403 BsrFI 7 300 309 4247 5095 BssHII 1 1401 1816 2600 2741 Enzyme Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraIII DrdI DrdII DsaI EaeI EagI EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I 1133 3794 MwoI NarI NciI NgoAIV NlaIII NlaIV NotI NruI NsiI NspI P?1108I P?MI # Sites 1 1 3 9 39 24 18 1 82 22 11 21 1 3 2 2 4 1 3 3 3 1 2 3 1 9 1 17 9 1 4 6 14 23 11 2 46 3 2 1 18 1 16 14 16 12 1 7 25 23 6 29 8 39 4 12 4 24 21 1 1 2 4 1 2 Locations 2862 1171 792 921 132 198 2283 3732 Enzyme PleI 1044 268 3743 # Sites Locations 9 251 539 3470 4525 PshAI 1 1835 Psp5II 1 2097 Psp1406I 4 652 2020 PvuI 1 4293 PvuII 3 1590 1683 RcaI 3 388 3811 RsaI 3 1137 2897 SacI 1 190 SalI 1 179 SapI 1 2975 Sau96I 14 Sau3AI 21 ScrFI 21 SfaNI 23 SfcI 4 236 3356 SgfI 1 4293 SgrAI 1 309 SmaI 1 4167 SphI 1 465 SspI 2 4218 4786 StyI 1 57 TaqI 15 TaqII 6 898 1116 4898 T?I 9 1669 1971 4204 4260 ThaI 35 TseI 23 Tsp45I 7 1171 1999 4440 5167 Tsp509I 19 Tth111I 1 2836 Tth111II 8 829 1522 3720 4129 UbaJI 18 VspI 5 251 1675 XcmI 3 846 1362 XhoI 1 158 XmnI 2 2649 4682 Enzymes that do not cut pET-24(+): AatII A?II AgeI BaeI BsaI BseRI Bsu36I DraI Eam1105I MscI MunI NcoI NspV PacI PmeI RleAI RsrII SacII S?I SnaBI SpeI StuI SunI SwaI 3935 4129 4491 626 4929 1422 4937

TB072 12/98

2985

554 4542

1766

2416 2682 4686 4128

4779

490 3405

974

2085

3984

3906

4090

4796

2006 447 5031 388 1849

2097 910 1201 2209

2376 1629 3948

1974 1477 1282 2702 2105

3182 3593 1316

3480 4612 1816

4994 2784 713 427 166 166 608 767 395 3639 525 53 192 713 3238 1440 1036 2636 2072 166 718 4380

3199 4999 2063 298 2975 3165 1896 4205 423 1028 3251

4949

3547

5213

430 4106 3311 2345

1664

2097 1568 4181 1625 4538 3117

1789 2141 4432

2993 2645 4523

4547 3066

1045 2777 298 2039

2310 3931 430 3106

2372 4537 1664 3117

2450

2530

2743

2838

3586

3893

3569

2552 4256 1734 1380

3681

3688

1951

2618

4492

4681

588 889 181 173 1496

3677 3979 1496 4521

2288 448 433 4165 1812

947 1625 4566 2280

1630 2063 3297

2251 3007 3431 4293

990 3306 4500

AscI BspMI FseI NdeI PmlI ScaI SrfI XbaI

AvrII BsrGI KpnI NheI PstI SexAI Sse8387I

3490 4971

1218 4309 2362 831 3616

1605

2732

1042 2664 84 2801 313 300

1330

1360

2078

2273

5209 863 3762

1020 3433 334 1888

1590 3678 448 2048

1683

2682

1630 5095

4692 676

5138 1888 2048

166 3950 4143 465 1877 572

4409 2436 4556

2728

3095

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-24a-d(+) Vectors
pET-24a DNA pET-24b DNA pET-24c DNA pET-24d DNA Cat. No. 69749-3 69750-3 69751-3 69752-3

TB070 12/98 The pET-24a-d(+) vectors carry an N-terminal T7?Tag? sequence plus an optional C-terminal His?Tag? sequence. These vectors differ from pET-21a-d(+) only by their selectable marker (kanamycin vs. ampicillin resistance). Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, singlestranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-24a(+) sequence landmarks

T7 promoter T7 transcription start T7?Tag coding sequence Multiple cloning sites (BamH I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

311-327 310 207-239 158-203 140-157 26-72 714-1793 3227 3936-4748 4844-5299
Pvu I(4367) Sgf I(4367) Sma I(4241) Sty I(57) Bpu1102 I(80) Dra III(5068)

Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) Nhe I(231) Nde I(238)

f1
Kan ( 393 6-4 74 8)

4-5299) (484 igin or

Xba I(276) Bgl II(342) SgrA I(383) Sph I(539)

The maps for pET-24b(+), pET-24c(+) and pET-24d(+) are the same as pET-24a(+) (shown) with the following exceptions: pET-24b(+) is a 5309bp plasmid; subtract 1bp from each site beyond BamH I at 198. pET-24c(+) is a 5308bp plasmid; subtract 2bp from each site beyond BamH I at 198. pET-24d(+) is a 5307bp plasmid; the BamH I site is in the same reading frame as in pET24c(+). An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 238 of pET-24c(+). As a result, Nco I cuts pET24d(+) at 234, and Nhe I cuts at 229. For the rest of the sites, subtract 3bp from each site beyond position 239 in pET-24a(+). Nde I does not cut pET-24d(+). Note also that Sty I is not unique in pET-24d(+).

Mlu I(1064) Bcl I(1078) BstE II(1245) Apa I(1275)

(714-1793) lacI

Cla I(4058) Nru I(4024)

pET-24a(+)
(5310bp)

Eco57 I(3713) AlwN I(3581)

BssH II(1475) EcoR V(1514) Hpa I(1570)

i(

or
BssS I(3338)

32

27

)

PshA I(1909) Bgl I(2128) Fsp I(2146) Psp5 II(2171)

BspLU11 I(3165) Sap I(3049) Bst1107 I(2936) Tth111 I(2910)

T7 promoter primer #69348-3

Bgl II

T7 promoter

lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I Nhe I
T7?Tag

Xba I

rbs

pET-24a

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeu pET-24d pET-24b pET-24c,d
Nco I

BamH I EcoR I Sac I

Sal I Hind III

Eag I Not I

Xho I

His?Tag

...GGTCGGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd ...GGTCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGlu
Bpu1102 I
T7 terminator

...TACCATGGCTAGC... MetAlaSer...

GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-24a-d(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-24a(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2935 7 831 1559 3117 4908 AciI 74 A?III 2 1064 3165 AluI 22 AlwI 13 Alw21I 7 159 190 2983 3483 Alw44I 3 1044 2979 AlwNI 1 3581 ApaI 1 1275 ApaBI 1 748 ApoI 6 192 1339 4881 AvaI 2 158 4239 AvaII 5 1616 1992 BamHI 1 198 BanI 8 386 407 1833 1959 BanII 6 190 448 5143 BbsI 4 1210 1549 BbvI 23 BccI 13 Bce83I 6 21 1878 3795 BcefI 6 583 924 5094 BcgI 9 160 194 1890 1924 BclI 1 1078 BfaI 7 70 232 3967 5219 BglI 1 2128 BglII 1 342 BmgI 1 1273 BpmI 4 902 1391 Bpu10I 2 2271 4384 Bpu1102I 1 80 BsaAI 2 2917 5068 BsaBI 3 341 347 BsaHI 5 387 408 BsaJI 9 57 501 3325 4238 BsaWI 7 2 1383 3518 4502 BsaXI 2 1723 5016 BsbI 2 2881 4975 BscGI 11 BsgI 3 915 1115 BsiI 1 3338 BsiEI 5 169 1849 BslI 23 BsmI 2 4251 4328 BsmAI 6 761 1166 4383 BsmBI 3 1679 2806 BsmFI 4 525 2066 BsoFI 41 Bsp24I 12 Bsp1286I 12 BspEI 2 2 2354 BspGI 1 2691 BspLU11I 1 3165 BsrI 22 BsrBI 4 297 3098 BsrDI 2 1111 1477 BsrFI 7 374 383 4321 5169 BssHII 1 1475 Bst1107I 1 2936 1890 2674 2815 Enzyme BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraIII DrdI DrdII DsaI EaeI EagI EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I 5283 MwoI NarI NciI NdeI NgoAIV NheI NlaIII NlaIV NotI NruI NsiI NspI P?1108I 39 4 12 1 4 1 25 21 1 1 2 4 1 # Sites 1 3 9 40 26 20 1 83 22 11 21 1 3 2 2 4 1 3 3 3 1 2 3 1 9 1 17 9 1 4 6 14 23 11 2 46 3 2 1 18 1 16 14 16 12 1 7 25 25 6 29 8 Locations 1245 866 995 132 198 2357 3806 1118 342 3817 Enzyme P?MI PleI 628 4616 1840 # Sites Locations 2 646 4630 9 325 613 3544 4599 PshAI 1 1909 Psp5II 1 2171 Psp1406I 4 726 2094 PvuI 1 4367 PvuII 3 1664 1757 RcaI 3 462 3885 RsaI 3 1211 2971 SacI 1 190 SalI 1 179 SapI 1 3049 Sau96I 14 Sau3AI 21 ScrFI 21 SfaNI 23 SfcI 4 310 3430 SgfI 1 4367 SgrAI 1 383 SmaI 1 4241 SphI 1 539 SspI 2 4292 4860 StyI 1 57 TaqI 15 TaqII 6 972 1190 4972 T?I 9 1743 2045 4278 4334 ThaI 36 TseI 23 Tsp45I 7 1245 2073 4514 5241 Tsp509I 20 Tth111I 1 2910 Tth111II 8 903 1596 3794 4203 UbaJI 18 VspI 5 325 1749 XbaI 1 276 XcmI 3 920 1436 XhoI 1 158 XmnI 2 2723 4756 700 5003 1496 5011

TB070 12/98

3059

2490 2756 4760 4202

4853

564 3479

1048

2159

4058

3980

4164

4870

2080 521 5105 462 1923

2171 984 1275 2283

2450 1703 4022

2048 1551 228 2742 277

3256 3667 1356 2776 2179

3554 4686 1390

5068 2858 787 501 166 166 682 841 469 3713 599 53 192 787 3312 1514 1110 2710 2146 166 792 4454

3273 5073 2137 372 3049 3239 1970 3713 4279 497 1102 3325

5023

504 4180 3385 2419

1738

3621

5287

2171 1642 4255 1699 4612 3191

1863 2215 4506

3067 2719 4597

4621 3140

1119 2851 372 2113

2384 4005 504 3180

2446 4611 1738 3191

2524

2604

2817

2912

3660

3643

2626 4330 1808 1454

3755

3762

2025

2692

662 963 181 173 1570

3751 4053 1570 4595

4566

4755

2362 522 507 4239 1886

1021 1699 4640 2354

1704 2137 3371

2325 3081 3505 4367

1064 3380 4574

3564 5045

4009

4203

4565

Enzymes that do not cut pET-24a(+): AatII A?II AgeI AscI BaeI BsaI BseRI BspMI Bsu36I DraI Eam1105I FseI MscI MunI NcoI NspV PmeI PmlI PstI RleAI SacII ScaI SexAI S?I SpeI SrfI Sse8387I StuI SwaI

AvrII BsrGI KpnI PacI RsrII SnaBI SunI

1292 4383 2436

1679

2806

1116 2738 84 2875 387 238 374 231

1404

1434

2152

2347

1094 3507 408

1664 3752 522

1757

2756

1704

1962

2122

5169

4766 750

5212 1962 2122

166 4024 4217 539 1951

4483 2510

2802

3169

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-24a-d(+) Vectors
pET-24a DNA pET-24b DNA pET-24c DNA pET-24d DNA Cat. No. 69749-3 69750-3 69751-3 69752-3

TB070 12/98 The pET-24a-d(+) vectors carry an N-terminal T7?Tag? sequence plus an optional C-terminal His?Tag? sequence. These vectors differ from pET-21a-d(+) only by their selectable marker (kanamycin vs. ampicillin resistance). Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, singlestranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-24a(+) sequence landmarks

T7 promoter T7 transcription start T7?Tag coding sequence Multiple cloning sites (BamH I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

311-327 310 207-239 158-203 140-157 26-72 714-1793 3227 3936-4748 4844-5299
Pvu I(4367) Sgf I(4367) Sma I(4241) Sty I(57) Bpu1102 I(80) Dra III(5068)

Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) Nhe I(231) Nde I(238)

f1
Kan ( 393 6-4 74 8)

4-5299) (484 igin or

Xba I(276) Bgl II(342) SgrA I(383) Sph I(539)

The maps for pET-24b(+), pET-24c(+) and pET-24d(+) are the same as pET-24a(+) (shown) with the following exceptions: pET-24b(+) is a 5309bp plasmid; subtract 1bp from each site beyond BamH I at 198. pET-24c(+) is a 5308bp plasmid; subtract 2bp from each site beyond BamH I at 198. pET-24d(+) is a 5307bp plasmid; the BamH I site is in the same reading frame as in pET24c(+). An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 238 of pET-24c(+). As a result, Nco I cuts pET24d(+) at 234, and Nhe I cuts at 229. For the rest of the sites, subtract 3bp from each site beyond position 239 in pET-24a(+). Nde I does not cut pET-24d(+). Note also that Sty I is not unique in pET-24d(+).

Mlu I(1064) Bcl I(1078) BstE II(1245) Apa I(1275)

(714-1793) lacI

Cla I(4058) Nru I(4024)

pET-24a(+)
(5310bp)

Eco57 I(3713) AlwN I(3581)

BssH II(1475) EcoR V(1514) Hpa I(1570)

i(

or
BssS I(3338)

32

27

)

PshA I(1909) Bgl I(2128) Fsp I(2146) Psp5 II(2171)

BspLU11 I(3165) Sap I(3049) Bst1107 I(2936) Tth111 I(2910)

T7 promoter primer #69348-3

Bgl II

T7 promoter

lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I Nhe I
T7?Tag

Xba I

rbs

pET-24a

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeu pET-24d pET-24b pET-24c,d
Nco I

BamH I EcoR I Sac I

Sal I Hind III

Eag I Not I

Xho I

His?Tag

...GGTCGGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd ...GGTCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA ...GlyArgIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGlu
Bpu1102 I
T7 terminator

...TACCATGGCTAGC... MetAlaSer...

GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-24a-d(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-24a(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2935 7 831 1559 3117 4908 AciI 74 A?III 2 1064 3165 AluI 22 AlwI 13 Alw21I 7 159 190 2983 3483 Alw44I 3 1044 2979 AlwNI 1 3581 ApaI 1 1275 ApaBI 1 748 ApoI 6 192 1339 4881 AvaI 2 158 4239 AvaII 5 1616 1992 BamHI 1 198 BanI 8 386 407 1833 1959 BanII 6 190 448 5143 BbsI 4 1210 1549 BbvI 23 BccI 13 Bce83I 6 21 1878 3795 BcefI 6 583 924 5094 BcgI 9 160 194 1890 1924 BclI 1 1078 BfaI 7 70 232 3967 5219 BglI 1 2128 BglII 1 342 BmgI 1 1273 BpmI 4 902 1391 Bpu10I 2 2271 4384 Bpu1102I 1 80 BsaAI 2 2917 5068 BsaBI 3 341 347 BsaHI 5 387 408 BsaJI 9 57 501 3325 4238 BsaWI 7 2 1383 3518 4502 BsaXI 2 1723 5016 BsbI 2 2881 4975 BscGI 11 BsgI 3 915 1115 BsiI 1 3338 BsiEI 5 169 1849 BslI 23 BsmI 2 4251 4328 BsmAI 6 761 1166 4383 BsmBI 3 1679 2806 BsmFI 4 525 2066 BsoFI 41 Bsp24I 12 Bsp1286I 12 BspEI 2 2 2354 BspGI 1 2691 BspLU11I 1 3165 BsrI 22 BsrBI 4 297 3098 BsrDI 2 1111 1477 BsrFI 7 374 383 4321 5169 BssHII 1 1475 Bst1107I 1 2936 1890 2674 2815 Enzyme BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraIII DrdI DrdII DsaI EaeI EagI EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I 5283 MwoI NarI NciI NdeI NgoAIV NheI NlaIII NlaIV NotI NruI NsiI NspI P?1108I 39 4 12 1 4 1 25 21 1 1 2 4 1 # Sites 1 3 9 40 26 20 1 83 22 11 21 1 3 2 2 4 1 3 3 3 1 2 3 1 9 1 17 9 1 4 6 14 23 11 2 46 3 2 1 18 1 16 14 16 12 1 7 25 25 6 29 8 Locations 1245 866 995 132 198 2357 3806 1118 342 3817 Enzyme P?MI PleI 628 4616 1840 # Sites Locations 2 646 4630 9 325 613 3544 4599 PshAI 1 1909 Psp5II 1 2171 Psp1406I 4 726 2094 PvuI 1 4367 PvuII 3 1664 1757 RcaI 3 462 3885 RsaI 3 1211 2971 SacI 1 190 SalI 1 179 SapI 1 3049 Sau96I 14 Sau3AI 21 ScrFI 21 SfaNI 23 SfcI 4 310 3430 SgfI 1 4367 SgrAI 1 383 SmaI 1 4241 SphI 1 539 SspI 2 4292 4860 StyI 1 57 TaqI 15 TaqII 6 972 1190 4972 T?I 9 1743 2045 4278 4334 ThaI 36 TseI 23 Tsp45I 7 1245 2073 4514 5241 Tsp509I 20 Tth111I 1 2910 Tth111II 8 903 1596 3794 4203 UbaJI 18 VspI 5 325 1749 XbaI 1 276 XcmI 3 920 1436 XhoI 1 158 XmnI 2 2723 4756 700 5003 1496 5011

TB070 12/98

3059

2490 2756 4760 4202

4853

564 3479

1048

2159

4058

3980

4164

4870

2080 521 5105 462 1923

2171 984 1275 2283

2450 1703 4022

2048 1551 228 2742 277

3256 3667 1356 2776 2179

3554 4686 1390

5068 2858 787 501 166 166 682 841 469 3713 599 53 192 787 3312 1514 1110 2710 2146 166 792 4454

3273 5073 2137 372 3049 3239 1970 3713 4279 497 1102 3325

5023

504 4180 3385 2419

1738

3621

5287

2171 1642 4255 1699 4612 3191

1863 2215 4506

3067 2719 4597

4621 3140

1119 2851 372 2113

2384 4005 504 3180

2446 4611 1738 3191

2524

2604

2817

2912

3660

3643

2626 4330 1808 1454

3755

3762

2025

2692

662 963 181 173 1570

3751 4053 1570 4595

4566

4755

2362 522 507 4239 1886

1021 1699 4640 2354

1704 2137 3371

2325 3081 3505 4367

1064 3380 4574

3564 5045

4009

4203

4565

Enzymes that do not cut pET-24a(+): AatII A?II AgeI AscI BaeI BsaI BseRI BspMI Bsu36I DraI Eam1105I FseI MscI MunI NcoI NspV PmeI PmlI PstI RleAI SacII ScaI SexAI S?I SpeI SrfI Sse8387I StuI SwaI

AvrII BsrGI KpnI PacI RsrII SnaBI SunI

1292 4383 2436

1679

2806

1116 2738 84 2875 387 238 374 231

1404

1434

2152

2347

1094 3507 408

1664 3752 522

1757

2756

1704

1962

2122

5169

4766 750

5212 1962 2122

166 4024 4217 539 1951

4483 2510

2802

3169

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-25b(+) Vector

TB065 12/98 The pET-25b(+) vector (Cat. No. 69753-3) carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal HSV?Tag? and His?Tag? sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Nhe I(197) Xho I(212) Eag I(220) Not I(220) Hind III(227) Sal I(233) Sac I(244) EcoR I(246) BamH I(252) Nco I(274) Msc I(279) BseR I(314) BspM I(322) Nde I(342) Xba I(380) Bgl II(446) SgrA I(487) Sph I(643) EcoN I(703) PflM I(750) ApaB I(852)

pET-25b(+) sequence landmarks

Bpu1102 I(80)

Pvu I(4532) Pst I(4407)

Ap (4 092 -49 49 )

T7 promoter T7 transcription start pelB coding sequence Multiple cloning sites (Nco I - Xho I) HSV?Tag coding sequence His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin bla coding sequence f1 origin

415-431 414 278-343 212-279 164-199 140-157 26-72 818-1897 3331 4092-4949 5081-5536
Dra III(5305)

081-5536) n (5 rigi o f1
Sca I(4642)

Mlu I(1168) Bcl I(1182) BstE II(1349) Apa I(1379)

18-1897) lacI (8

Bsa I(4223)
Eam1105 I(4162) –

pET-25b(+)
(5547bp)

BssH II(1579) Hpa I(1674)

AlwN I(3685)

ri

BspLU11 I(3269) Sap I(3153) Bst1107 I(3040) Tth111 I(3014) BspG I(2795)

o

(3

33

1)

PshA I(2013)

Psp5 II(2275) Bpu10 I(2375)

T7 promoter primer #69348-3

Bgl II Nde I BspM I

T7 promoter pelB leader

lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Msc I Nco I

Xba I

rbs

TATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCATGGATATCGGAATTAATTCGGATCCGAATTCGAGCTCC MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeuLeuLeuAlaAlaGlnProAlaMetAlaMetAspIleGlyIleAsnSerAspProAsnSerSerSer GTCGACAAGCTTGCGGCCGCACTCGAGATCAAACGGGCTAGCCAGCCAGAACTCGCCCCGGAAGACCCCGAGGATGTCGAGCACCACCACCACCACCACTGAGATCCGGCTG ValAspLysLeuAlaAlaAlaLeuGluIleLysArgAlaSerGlnProGluLeuAlaProGluAspProGluAspValGluHisHisHisHisHisHisEnd
Bpu1102 I
T7 terminator

BamH I EcoR I Sac I

Sal I

Hind III

Eag I Not I

Xho I

Nhe I

signal peptidase HSV?Tag

His?Tag

CTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-25b(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-25b(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 234 3039 8 935 1663 3221 4461 AciI 81 A?III 2 1168 3269 AluI 25 AlwI 16 Alw21I 9 159 244 3087 3587 Alw44I 4 1148 3083 AlwNI 1 3685 ApaI 1 1379 ApaBI 1 852 ApoI 4 246 1443 AvaI 2 167 212 AvaII 7 1720 2096 4300 4522 BamHI 1 252 BanI 9 490 511 1937 2063 BanII 4 244 552 BbsI 5 166 1314 BbvI 31 BccI 14 Bce83I 7 21 1982 3899 4767 BcefI 5 687 1028 BcgI 10 214 248 2028 2846 BclI 1 1182 BfaI 8 70 198 4017 4352 BglI 3 291 2232 BglII 1 446 BmgI 1 1377 BpmI 5 1006 1495 Bpu10I 1 2375 Bpu1102I 1 80 BsaI 1 4223 BsaAI 2 3021 5305 BsaBI 3 445 451 BsaHI 6 491 512 4699 BsaJI 9 57 166 611 1803 BsaWI 7 2 1487 3622 4453 BsaXI 2 1827 5253 BsbI 2 2985 5212 BscGI 14 BseRI 1 314 BsgI 3 1019 1219 BsiI 2 3442 4826 BsiEI 7 223 325 4532 4681 BslI 20 BsmAI 7 865 1270 4223 4999 BsmBI 2 1783 2910 BsmFI 4 629 2170 BsoFI 51 Bsp24I 10 458 490 1343 3762 Bsp1286I 12 BspEI 2 2 2458 BspGI 1 2795 BspLU11I 1 3269 BspMI 1 322 BsrI 25 BsrBI 4 401 3202 BsrDI 4 1215 1581 1994 5145 2778 2919 # Sites Locations 8 285 478 2226 4242 BssHII 1 1579 Bst1107I 1 3040 BstEII 1 1349 BstXI 3 970 1099 BstYI 12 Cac8I 41 CjeI 24 CjePI 18 CviJI 89 CviRI 24 DdeI 11 DpnI 28 DraI 3 4028 4047 DraIII 1 5305 DrdI 3 2962 3377 DrdII 2 891 5310 DsaI 3 274 605 EaeI 6 220 277 4550 EagI 1 220 Eam1105I 1 4162 EarI 3 786 3153 EciI 4 945 3343 Eco47III 3 573 2074 Eco57I 2 3817 4829 EcoNI 1 703 EcoO109I 3 53 601 EcoRI 1 246 EcoRII 7 891 1206 3416 3429 EcoRV 2 271 1618 FauI 17 FokI 12 FspI 2 2250 4384 GdiII 5 220 476 HaeI 6 279 896 3747 HaeII 14 HaeIII 25 HgaI 12 HgiEII 2 766 3855 HhaI 45 Hin4I 3 1067 4161 HincII 2 235 1674 HindIII 1 227 HinfI 14 HpaI 1 1674 HphI 16 MaeII 15 MaeIII 18 MboII 15 MluI 1 1168 MmeI 3 3484 3668 MnlI 28 MscI 1 279 MseI 29 MslI 9 1220 1508 2842 4414 MspI 33 MspA1I 10 84 321 2860 2979 MwoI 39 NarI 4 491 512 NciI 13 NcoI 1 274 NdeI 1 342 NgoAIV 5 285 478 NheI 1 197 NlaIII 25 NlaIV 24 Enzyme BsrFI 487 5406 854 2066 Enzyme NotI NspI P?1108I P?MI PleI # Sites 1 4 2 1 9 Locations 220 643 2614 2055 4180 750 429 717 3648 4151 2013 2275 830 2198 5090 4407 4532 1768 1861 566 3989 1315 3075 244 233 3153 2906 3273

TB065 12/98

1222 PshAI 1 Psp5II 1 Psp1406I 6 PstI PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I 608 2217 1842 3284 4550 3295 Tsp509I Tth111I Tth111II UbaJI VspI XbaI XcmI XhoI XmnI 1 1 3 3 3 1 1 1 18 28 1 20 21 5 1 1 2 2 14 9 5 34 31 8 18 1 6 20 5 1 3 1 3

804 5240

1600 5248

3163

668 4748 3583

1152 4833 4829

2263

2594

4388

4761

5107 2184

5118 2275 2554

4739 5260 2241 476

2860 4997 4642

625 4110 566 1653

1088 5342 1379 2027

1807

608

1842

4642

2387

2152 1655 1460 2880 381 5456 4282

3360 3771 1494 4667 2283

3658 5331 1994 4701 3764

4957 3489 2523

4317

414 487 643 4966 57 1076 4695 1847

3534

3725

4403

5524

5097 274 1294 4848 2149 1967 4865 2319 3171 5209 2823 4510 3244

2275 1746 1803 3295

2129

2796

4232

1349 4418 3014 1007 3898 261 380 1024 212 262

2177 4629

2708 5478

2921

3016

1700

2730

3859

3866

2466 626 178 2241 1990

1125 274 3429 2458

1808 605 3475

429 1540 2827

1853 1558 4761

1912

4334

4235

2429 1953 3185 3609

5282

Enzymes that do not cut pET-25b(+): AatII A?II AgeI AscI BaeI BsmI BsrGI Bsu36I FseI KpnI MunI NruI NspV PacI PmeI PmlI RsrII SacII SexAI S?I SmaI SnaBI SpeI SrfI StuI SunI SwaI

AvrII ClaI NsiI RleAI SgfI Sse8387I

1396

1783

2910

2540 1009 3794

5520 1041 3940 1311 3972

1538 4573 1198 3611 626

2256 4932 1768 3856 1808

2451

1861 4797

2066

2226

5406

5003 4223

5449 4397

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-26b(+) Vector

TB071 12/98 The pET-26b(+) vector (Cat. No. 69862-3) carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His?Tag? sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-26b(+) sequence landmarks

Pvu I(4417) Sgf I(4417) Sma I(4291) Cla I(4108) Nru I(4074)

kan (3 986 -47 98 )

T7 promoter T7 transcription start pelB coding sequence Multiple cloning sites (Nco I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

361-377 360 224-289 158-225 140-157 26-72 764-1843 3277 3986-4798 4894-5349
Dra III(5118)

Bpu1102 I(80)

f1

4-5349) (489 gin ori

Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) Nco I(220) Msc I(225) BseR I(260) BspM I(268) Nde I(288) Xba I(326) Bgl II(392) SgrA I(433) Sph I(589) ApaB I(798)

Mlu I(1114) Bcl I(1128) BstE II(1295) Bmg I(1323) Apa I(1325) BssH II(1525)

64-1843) lacI (7

pET-26b(+)
(5360bp)
Eco57 I(3763)

Hpa I(1620) AlwN I(3631)

i(

or
Bsi I(3388)

32

77

)

PshA I(1959) Pfl1108 I(2001) Fsp I(2196) Psp5 II(2221)

BspLU11 I(3215) Sap I(3099) Bst1107 I(2986) Tth111 I(2960) BspG I(2741)

T7 promoter primer #69348-3

Bgl II Nde I BspM I

T7 promoter pelB leader

lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Msc I Nco I

Xba I

rbs

TATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCATGGATATCGGAATTAATTCGGATCCGAATTCGAGCTCC MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeuLeuLeuAlaAlaGlnProAlaMetAlaMetAspIleGlyIleAsnSerAspProAsnSerSerSer GTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAAC ValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd
T7 terminator T7 terminator primer #69337-3

BamH I EcoR I Sac I

Sal I

Hind III

Eag I Not I

Ava I* Xho I

signal peptidase His?Tag

Bpu1102 I

TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-26b(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-26b(+) Restriction Map
Enzyme AccI AceIII # Sites Locations 2 180 2985 7 881 1609 3167 4958 AciI 74 A?III 2 1114 3215 AluI 22 AlwI 13 Alw21I 7 159 190 3033 3533 Alw44I 3 1094 3029 AlwNI 1 3631 ApaI 1 1325 ApaBI 1 798 ApoI 6 192 1389 4931 AvaI 2 158 4289 AvaII 5 1666 2042 BamHI 1 198 BanI 8 436 457 1883 2009 BanII 6 190 498 5193 BbsI 4 1260 1599 BbvI 28 BccI 14 Bce83I 6 21 1928 3845 BcefI 6 633 974 5144 BcgI 8 160 194 1974 2792 BclI 1 1128 BfaI 6 70 327 5269 BglI 2 237 2178 BglII 1 392 BmgI 1 1323 BpmI 4 952 1441 Bpu10I 2 2321 4434 Bpu1102I 1 80 BsaAI 2 2967 5118 BsaBI 3 391 397 BsaHI 5 437 458 BsaJI 10 57 220 2187 3375 BsaWI 7 2 1433 3568 4552 BsaXI 2 1773 5066 BsbI 2 2931 5025 BscGI 11 BseRI 1 260 BsgI 3 965 1165 BsiI 1 3388 BsiEI 6 169 271 4417 BslI 23 BsmI 2 4301 4378 BsmAI 6 811 1216 4433 BsmBI 3 1729 2856 BsmFI 4 575 2116 BsoFI 46 Bsp24I 10 404 436 1289 3708 Bsp1286I 12 BspEI 2 2 2404 BspGI 1 2741 BspLU11I 1 3215 BspMI 1 268 BsrI 21 BsrBI 4 347 3148 BsrDI 2 1161 1527 1940 2724 2865 # Sites Locations 8 231 424 2172 4371 BssHII 1 1525 Bst1107I 1 2986 BstEII 1 1295 BstXI 3 916 1045 BstYI 9 132 198 2407 3856 Cac8I 40 CjeI 24 CjePI 18 ClaI 1 4108 CviJI 84 CviRI 22 DdeI 11 DpnI 21 DraIII 1 5118 DrdI 3 2908 3323 DrdII 2 837 5123 DsaI 3 220 551 EaeI 5 166 223 EagI 1 166 EarI 3 732 3099 EciI 3 891 3289 Eco47III 3 519 2020 Eco57I 1 3763 EcoNI 2 649 4329 EcoO109I 3 53 547 EcoRI 1 192 EcoRII 9 837 1152 3362 3375 EcoRV 2 217 1564 FauI 17 FokI 9 1160 1169 2760 2901 FspI 1 2196 GdiII 4 166 422 HaeI 7 225 842 3693 4504 HaeII 14 HaeIII 24 HgaI 11 HgiEII 2 712 3801 HhaI 46 Hin4I 3 1013 4103 HincII 2 181 1620 HindIII 1 173 HinfI 18 HpaI 1 1620 HphI 16 MaeII 14 MaeIII 16 MboII 12 MluI 1 1114 MmeI 7 3430 3614 4624 5095 MnlI 26 MscI 1 225 MseI 26 MslI 6 1166 1454 2788 MspI 30 MspA1I 9 84 267 2806 2925 MwoI 40 NarI 4 437 458 NciI 12 NcoI 1 220 NdeI 1 288 NgoAIV 5 231 424 NlaIII 25 NlaIV 21 Enzyme BsrFI 433 5219 800 2012 Enzyme NotI NruI NsiI NspI P?1108I P?MI PleI PshAI Psp5II Psp1406I PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SspI StyI TaqI TaqII T?I 2434 4055 554 2163 2496 4661 1788 3230 2574 ThaI TseI Tsp45I 3241 Tsp509I Tth111I Tth111II UbaJI VspI 4645 XbaI XcmI XhoI XmnI 1 3 1 3 22 1 8 18 6 35 28 7 # Sites 1 1 2 4 1 2 9 1 1 4 1 3 3 3 1 1 1 14 21 21 23 4 1 1 1 1 2 2 15 6 9 Locations 166 4074 4267 4533 589 2560 2001 696 4680 375 663 3594 4649 1959 2221 776 2144 4417 1714 1807 512 3935 1261 3021 190 179 3099

TB071 12/98

2852

3219

614 3529

1098

2209

1168 392 3867

678 4666

1890

750 5053

1546 5061

3109

2540 2806 4810 4252

4903

4030

4214

4920

2130 571 5155 512 1973

2221 1034 1325 2333

2500 1753 4072

5073 2187 422 4230 3435 2469

554

1788

2098 1601 1406 2826 2229

3306 3717 1440

3604 4736 1940

2221 1692 4305 1749 4662 3241

360 4417 433 4291 589 4342 57 1022 5022 1793 4328

3480

3671

5337

4910 220 1240 2095 4384 1913 2265 4556 3117 2769 4647 4671 3190

3710

4017

2075

2742

1295 4564 2960 953 3844 207 4805 326 970 158 208

2123 5291

2654

2867

2962

2412 572 551 4288 1936

1646 4253 375

2676 4380 1799

3805

3812

1071 557 4289 2404

1754 1749 4690 3421

1858

4616

1486 2773

1504 4806

2375 1899 3131 3555

4059

4253

4615

1342 4433 2486 955 3740

1729

2856

Enzymes that do not cut pET-26b(+): AatII A?II AgeI AscI BaeI BsaI BsrGI Bsu36I Eam1105I FseI KpnI MunI NspV PacI PmeI PmlI RleAI RsrII SacII ScaI S?I SnaBI SpeI SrfI StuI SunI SwaI

AvrII DraI NheI PstI SexAI Sse8387I

1484

2202

2397

5333 987 3886 1257 3918

1144 3557 572

1714 3802 1754

1807

2012

2172

5219

4816

5262

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-27b(+) Vector

TB073 12/98 The pET-27b(+) vector (Cat. No. 69863-3) carries an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal HSV?Tag? and His?Tag? sequences. This vector differs from pET-25b(+) only by its selectable marker (kanamycin vs. ampicillin resistance). Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
Nhe I(197) Xho I(212) Not I(220) Eag I(220) Hind III(227) Sal I(233) Sac I(244) EcoR I(246) BamH I(252) Nco I(274) Msc I(279) BseR I(314) Bpu1102 I(80) BspM I(322) Nde I(342) Xba I(380) Bgl II(446) SgrA I(487) Sph I(643)

pET-27b(+) sequence landmarks

Sgf I(4471) Sma I(4345)

Kan ( 404 0-4 85 2)

T7 promoter T7 transcription start pelB coding sequence Multiple cloning sites (Nco I - Xho I) HSV?Tag coding sequence His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

415-431 414 278-343 212-279 164-199 140-157 26-72 818-1897 3331 4040-4852 4948-5403

Dra III(5172)

f1

5403) 4948in ( rig o

Cla I(4162) Nru I(4128)

Mlu I(1168) Bcl I(1182) BstE II(1349) Apa I(1379)

lacI (818-1897)

pET-27b(+)
(5414bp)

Eco57 I(3817) AlwN I(3685)

BssH II(1579) Hpa I(1674)

or
BssS I(3442)

(3

BspLU11 I(3269) Sap I(3153) Bst1107 I(3040) Tth111 I(3014)

i

33

1)

PshA I(2013) Fsp I(2250) Psp5 II(2275)

T7 promoter primer #69348-3

Bgl II Nde I BspM I

T7 promoter

lac operator pelB leader BseR I

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Msc I Nco I

Xba I

rbs

TATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCATGGATATCGGAATTAATTCGGATCCGAATTCGAGCTCC MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeuLeuLeuAlaAlaGlnProAlaMetAlaMetAspIleGlyIleAsnSerAspProAsnSerSerSer GTCGACAAGCTTGCGGCCGCACTCGAGATCAAACGGGCTAGCCAGCCAGAACTCGCCCCGGAAGACCCCGAGGATGTCGAGCACCACCACCACCACCACTGAGATCCGGCTG ValAspLysLeuAlaAlaAlaLeuGluIleLysArgAlaSerGlnProGluLeuAlaProGluAspProGluAspValGluHisHisHisHisHisHisEnd
Bpu1102 I
T7 terminator

BamH I EcoR I Sac I

Sal I

Hind III

Eag I Not I

Xho I

Nhe I

signal peptidase HSV?Tag

His?Tag?

CTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-27b(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-27b(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 234 3039 7 935 1663 3221 5012 AciI 74 A?III 2 1168 3269 AluI 22 AlwI 13 Alw21I 7 159 244 3087 3587 Alw44I 3 1148 3083 AlwNI 1 3685 ApaI 1 1379 ApaBI 1 852 ApoI 6 246 1443 4985 AvaI 3 167 212 AvaII 5 1720 2096 BamHI 1 252 BanI 8 490 511 1937 2063 BanII 6 244 552 5247 BbsI 5 166 1314 BbvI 28 BccI 14 Bce83I 6 21 1982 3899 BcefI 6 687 1028 5198 BcgI 8 214 248 2028 2846 BclI 1 1182 BfaI 7 70 198 4071 5323 BglI 2 291 2232 BglII 1 446 BmgI 1 1377 BpmI 4 1006 1495 Bpu10I 2 2375 4488 Bpu1102I 1 80 BsaAI 2 3021 5172 BsaBI 3 445 451 BsaHI 5 491 512 BsaJI 12 BsaWI 7 2 1487 3622 4606 BsaXI 2 1827 5120 BsbI 2 2985 5079 BscGI 12 BseRI 1 314 BsgI 3 1019 1219 BsiI 1 3442 BsiEI 6 223 325 4471 BslI 23 BsmI 2 4355 4432 BsmAI 6 865 1270 4487 BsmBI 3 1783 2910 BsmFI 4 629 2170 BsoFI 46 Bsp24I 10 458 490 1343 3762 Bsp1286I 12 BspEI 2 2 2458 BspGI 1 2795 BspLU11I 1 3269 BspMI 1 322 BsrI 21 BsrBI 4 401 3202 BsrDI 2 1215 1581 1994 2778 2919 # Sites Locations 8 285 478 2226 4425 BssHII 1 1579 Bst1107I 1 3040 BstEII 1 1349 BstXI 3 970 1099 BstYI 9 132 252 2461 3910 Cac8I 42 CjeI 24 CjePI 18 ClaI 1 4162 CviJI 87 CviRI 22 DdeI 11 DpnI 22 DraIII 1 5172 DrdI 3 2962 3377 DrdII 2 891 5177 DsaI 3 274 605 EaeI 5 220 277 EagI 1 220 EarI 3 786 3153 EciI 3 945 3343 Eco47III 3 573 2074 Eco57I 1 3817 EcoNI 2 703 4383 EcoO109I 3 53 601 EcoRI 1 246 EcoRII 9 891 1206 3416 3429 EcoRV 2 271 1618 FauI 17 FokI 10 149 1214 2628 2814 FspI 1 2250 GdiII 4 220 476 HaeI 7 279 896 3747 4558 HaeII 14 HaeIII 24 HgaI 11 HgiEII 2 766 3855 HhaI 46 Hin4I 3 1067 4157 HincII 2 235 1674 HindIII 1 227 HinfI 18 HpaI 1 1674 HphI 16 MaeII 14 MaeIII 16 MboII 13 MluI 1 1168 MmeI 7 3484 3668 4678 5149 MnlI 27 MscI 1 279 MseI 26 MslI 6 1220 1508 2842 MspI 31 MspA1I 9 84 321 2860 2979 MwoI 40 NarI 4 491 512 NciI 13 NcoI 1 274 NdeI 1 342 NgoAIV 5 285 478 NheI 1 197 NlaIII 25 Enzyme BsrFI 487 5273 854 2066 Enzyme NlaIV NotI NruI NsiI NspI P?1108I P?MI PleI PshAI Psp5II Psp1406I PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II UbaJI VspI XbaI XcmI XhoI XmnI # Sites 21 1 1 2 4 1 2 9 1 1 4 1 3 3 3 1 1 1 14 22 22 23 4 1 1 1 1 2 2 16 6 9 35 28 7 22 1 8 18 6 1 3 1 3 Locations 220 4128 4321 643 2055 750 429 3648 2013 2275 830 4471 1768 566 1315 244 233 3153

TB073 12/98

4587 2614 4734 717 4703

2906

3273

668 3583

1152

2263

1222 446 3921

732 4720

1944

804 5107

1600 5115

3163

2198 1861 3989 3075

2594 2860 4864 4306

4957

4084 4343 2184 625 5209 566 1653

4268

4974

2275 1088 1379 2027

2554 1807 4126 2387

5127 2241 476 4284 3489 2523

608

1842

2152 1655 1460 2880 381

3360 3771 1494

3658 4790 1994

2275 1746 4359 1803 4716 3295

414 4471 487 4345 643 4396 57 1076 5076 1847 4382

3534

3725

5391

4964 274 1294 2149 4438 1967 2319 4610 3171 2823 4701 4725 3244

2283

3764

1223 2955 608 2217

2488 4109 1842 3284

2550 4715

2129

2796

3295

1349 4618 3014 1007 3898 261 4859 380 1024 212 262

2177 5345

2708

2921

3016

2466 626 1990

1125 2458

1808 3475

1700 4307 429

2730 4434 1853

3859

3866

4699

1912

4670

1540 2827

1558 4860

2429 1953 3185 3609

4113

4307

4669

1396 4487 2540 1009 3794

1783

2910

Enzymes that do not cut pET-27b(+): AatII A?II AgeI AscI BaeI BsaI BsrGI Bsu36I Eam1105I FseI KpnI MunI PacI PmeI PmlI PstI RsrII SacII ScaI SexAI SnaBI SpeI SrfI Sse8387I SunI SwaI

AvrII DraI NspV RleAI S?I StuI

5387 1041 3940 1311 3972

1538

2256

2451

1198 3611 626

1768 3856 1808

1861

4870

5316

2066

2226

5273

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-28a-c(+) Vectors
pET-28a DNA pET-28b DNA pET-28c DNA Cat. No. 69864-3 69865-3 69866-3

TB074 12/98 The pET-28a-c(+) vectors carry an N-terminal His?Tag?/thrombin/T7?Tag? con?guration plus an optional C-terminal His?Tag sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, singlestranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-28a(+) sequence landmarks

Pvu I(4426) Sgf I(4426) Sma I(4300)

Kan ( 399 5-4 80 7)

T7 promoter T7 transcription start His?Tag coding sequence T7?Tag coding sequence Multiple cloning sites (BamH I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

370-386 369 270-287 207-239
Dra III(5127)

Bpu1102 I(80)

Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) Nhe I(231) Nde I(238) Nco I(296) Xba I(335) Bgl II(401) SgrA I(442) Sph I(598)

158-203 140-157 26-72 773-1852 3286 3995-4807 4903-5358

5358) 4903in ( rig o f1

The maps for pET-28b(+) and pET-28c(+) are the same as pET-28a(+) (shown) with the following exceptions: pET-28b(+) is a 5368bp plasmid; subtract 1bp from each site beyond BamH I at 198. pET-28c(+) is a 5367bp plasmid; subtract 2bp from each site beyond BamH I at 198.

Mlu I(1123) Bcl I(1137) BstE II(1304) Apa I(1334) BssH II(1534) EcoR V(1573) Hpa I(1629)

73-1852) lacI (7

Cla I(4117) Nru I(4083)

pET-28a(+)
(5369bp)
Eco57 I(3772) AlwN I(3640)

or
BssS I(3397)

(3

BspLU11 I(3224) Sap I(3108) Bst1107 I(2995) Tth111 I(2969)

i

28

6)

PshA I(1968) Bgl I(2187) Fsp I(2205) Psp5 II(2230)

T7 promoter primer #69348-3 pET upstream primer #69214-3 Bgl II T7 promoter His?Tag lac operator

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAA MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuValProArgGlySerHisMetAlaSerMetThrGlyGlyGlnGln ATGGGTCGCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC MetGlyArgGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeuArgSerGlyCysEnd ...GGTCGGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC ...GlyArgAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd
BamH I EcoR I Sac I Sal I Hind III Eag I Not I Xho I
thrombin His?Tag

Xba I

rbs T7?Tag

Nco I

Nde I Nhe I

pET-28a(+) pET-28b(+)

...GGTCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC pET-28c(+) ...GlyArgIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGluIleArgLeuLeuThrLysPro... GAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

Bpu1102 I

T7 terminator

pET-28a-c(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-28a(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2994 7 890 1618 3176 4967 AciI 77 A?III 2 1123 3224 AluI 22 AlwI 13 Alw21I 7 159 190 3042 3542 Alw44I 3 1103 3038 AlwNI 1 3640 ApaI 1 1334 ApaBI 1 807 ApoI 6 192 1398 4940 AvaI 2 158 4298 AvaII 5 1675 2051 BamHI 1 198 BanI 9 253 445 1762 1892 BanII 6 190 507 5202 BbsI 4 1269 1608 BbvI 27 BccI 14 Bce83I 6 21 1937 3854 BcefI 6 642 983 5153 BcgI 9 160 194 1949 1983 BclI 1 1137 BfaI 7 70 232 4026 5278 BglI 1 2187 BglII 1 401 BmgI 1 1332 BpmI 4 961 1450 Bpu10I 2 2330 4443 Bpu1102I 1 80 BsaAI 2 2976 5127 BsaBI 3 400 406 BsaHI 5 446 467 BsaJI 10 57 296 2196 3384 BsaWI 7 2 1442 3577 4561 BsaXI 2 1782 5075 BsbI 2 2940 5034 BscGI 11 BsgI 3 974 1174 BsiI 1 3397 BsiEI 5 169 1908 BslI 23 BsmI 2 4310 4387 BsmAI 6 820 1225 4442 BsmBI 3 1738 2865 BsmFI 4 584 2125 BsoFI 48 Bsp24I 12 Bsp1286I 12 BspEI 2 2 2413 BspGI 1 2750 BspLU11I 1 3224 BsrI 22 BsrBI 4 356 3157 BsrDI 2 1170 1536 BsrFI 7 433 442 4380 5228 BssHII 1 1534 Bst1107I 1 2995 1949 2733 2874 Enzyme BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraIII DrdI DrdII DsaI EaeI EagI EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I 5342 MwoI NarI NciI NcoI NdeI NgoAIV NheI NlaIII NlaIV NotI NruI NsiI NspI 39 4 12 1 1 4 1 26 22 1 1 2 4 # Sites 1 3 9 40 26 30 1 86 22 11 21 1 3 2 3 4 1 3 3 3 1 2 3 1 10 1 17 9 1 4 6 14 24 11 2 47 3 2 1 18 1 16 14 16 12 1 7 25 25 6 29 9 Locations 1304 925 1054 132 198 2416 3865 1177 401 3876 687 4675 1899 Enzyme P?1108I P?MI PleI PshAI Psp5II Psp1406I PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SspI StyI TaqI TaqII T?I 1169 2769 2205 166 851 4513 1178 2910 431 2172 2443 4064 563 3239 2505 4670 1797 3250 2583 ThaI TseI Tsp45I 3702 Tsp509I Tth111I Tth111II 3810 4112 1629 4654 UbaJI VspI XbaI XcmI XhoI XmnI 20 1 8 21 5 1 3 1 2 38 27 7 # Sites 1 2 9 1 1 4 1 3 3 3 1 1 1 14 21 22 23 4 1 1 1 1 2 2 15 6 9 Locations 2010 705 4689 384 672 3603 4658 1968 2230 785 2153 4426 1723 1816 521 3944 1270 3030 190 179 3108 759 5062 1555 5070

TB074 12/98

3118

2549 2815 4819 4261

4912

623 3538

1107

2218

4117

4039

4223

4929

2139 466 2018 521 1982

2230 580 5164 1334 2342

2509 1043 4081

2107 1610 228 2801 336

3315 3726 1415 2835 2238

3613 4745 1449

5127 2917 846 296 166 166 741 900 528 3772 658 53 192 256 3250 1573

3332 5132 560 431 3108 3298 2029 4338 556 846 3371

5082 2196 563 4239 3444 2478

1797

2230 1161 3384 1701 4314 1758 4671

369 4426 442 4300 598 4351 57 1031 5031 1802 4337

3489

3680

5346

4919 296 1249 2104 4393 1922 2274 4565 3126 2778 4656 4680 3199

3719

1304 4573 2969 962 3853 384 335 979 158 2782

2132 5300

2663

2876

2971

2084

2751

1655 4262 1808 1495 4815

2685 4389 1867 1513

3814

3821

721 1022 181 173 1629

4625

4814

2421 581 560 4297 1945

1080 566 4298 2413

1763 1758 4699 3430

2384 3140 3564 4426

1123 3439 4633

3623 5104

4068

4262

4624

Enzymes that do not cut pET28a(+): AatII A?II AgeI BaeI BsaI BseRI Bsu36I DraI Eam1105I MscI MunI NspV PmlI PstI RleAI ScaI SexAI S?I SrfI Sse8387I StuI

AscI BspMI FseI PacI RsrII SnaBI SunI

AvrII BsrGI KpnI PmeI SacII SpeI SwaI

1351 4442 2495

1738

2865

1175 2797 84 2815 446 296 238 433 231

1463

1493

2211

2406

264 2934 467

1153 3566 581

1723 3811 1763

1816

2021

2181

5228

4825 809

5271 2021 2181

166 4083 4276 598

4542 2569

2861

3228

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-29a-c(+) Vectors
pET-29a DNA pET-29b DNA pET-29c DNA Cat. No. 69871-3 69872-3 69873-3

TB076 12/98 The pET-29a-c(+) vectors carry an N-terminal S?Tag?/thrombin con?guration plus an optional C-terminal His?Tag? sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-29a(+) sequence landmarks

Sgf I(4428) Pvu I(4428) Sma I(4302)

The maps for pET-29b(+) and pET-29c(+) are the same as pET-29a(+) (shown) with the following exceptions: pET-29b(+) is a 5370bp plasmid; subtract 1bp from each site beyond BamH I at 198. pET-29c(+) is a 5372bp plasmid; add 1bp to each site beyond BamH I at 198.

Kan ( 399 7-4 80 9)

T7 promoter T7 transcription start S?Tag coding sequence Multiple cloning sites (Nco I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

368-384 367 249-293 158-217 140-157 26-72 775-1854 3288 3997-4809 4905-5360
Dra III(5129)

Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) EcoR V(206) Nco I(212) Kpn I(238) Bgl II(241) Bpu1102 I(80) Nsp V(268) Nde I(295) Xba I(333) SgrA I(444) Sph I(600)

905-5360) n (4 rigi o f1

Mlu I(1125) Bcl I(1139) BstE II(1306) Apa I(1336)

75-1854) lacI (7

Nru I(4085)

pET-29a(+)
(5371bp)

Eco57 I(3774) AlwN I(3642)

BssH II(1536) Hpa I(1631)

or
BssS I(3399)

(3

BspLU11 I(3226) Sap I(3110) Bst1107 I(2997) Tth111 I(2971)

i

28

8)

PshA I(1970) Bfa I(2189) Fsp I(2207) Psp5 II(2232)

T7 promoter primer #69348-3 pET upstream primer #69214-3 T7 promoter S?Tag Nsp V lac operator

AGATCGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACATATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCCCAGATCTGGGTACCCTGGTGCCACGCGGTTCC MetLysGluThrAlaAlaAlaLysPheGluArgGlnHisMetAspSerProAspLeuGlyThrLeuValProArgGlySer
Nco I Nde I Bgl II Kpn I

Xba I

rbs

ATGGCTGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC MetAlaAspIleGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeuArgSerGlyCysEnd ...GCGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC ...AlaIleSerAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd

EcoR V BamH I EcoR I Sac I

Sal I Hind III

Eag I Not I

thrombin

Xho I

His?Tag

pET-29a(+) pET-29b(+)

...GGATATCTGTGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC pET-29c(+) ...GlyTyrLeuTrpIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGluIleArgLeuLeuThrLysPro...
Bpu1102 I
T7 terminator primer #69337-3 T7 terminator

GAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-29a-c(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-29a(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 2996 7 892 1620 3178 4969 AciI 75 A?III 2 1125 3226 AluI 22 AlwI 13 Alw21I 7 159 190 3044 3544 Alw44I 3 1105 3040 AlwNI 1 3642 ApaI 1 1336 ApaBI 1 809 ApoI 7 192 270 4931 4942 AvaI 2 158 4300 AvaII 5 1677 2053 BaeI 1 233 BamHI 1 198 BanI 10 226 234 1045 1764 BanII 6 190 509 5204 BbsI 4 1271 1610 BbvI 25 BccI 13 Bce83I 6 21 1939 3856 BcefI 6 644 985 5155 BcgI 8 160 194 1985 2803 BclI 1 1139 BfaI 1 2189 BglII 1 241 BmgI 1 1334 BpmI 4 963 1452 Bpu10I 2 2332 4445 Bpu1102I 1 80 BsaAI 2 2978 5129 BsaBI 3 398 408 BsaHI 5 448 469 BsaJI 11 BsaWI 7 2 1444 3579 4563 BsaXI 2 1784 5077 BsbI 2 2942 5036 BscGI 11 BsgI 3 976 1176 BsiI 1 3399 BsiEI 5 169 1910 BslI 26 BsmI 2 4312 4389 BsmAI 6 822 1227 4444 BsmBI 3 1740 2867 BsmFI 4 586 2127 BsoFI 43 Bsp24I 10 415 447 1300 3719 Bsp1286I 12 BspEI 2 2 2415 BspGI 1 2752 BspLU11I 1 3226 BsrI 21 BsrBI 4 354 3159 BsrDI 2 1172 1538 BsrFI 7 435 444 4382 5230 BssHII 1 1536 Bst1107I 1 2997 BstEII 1 1306 1951 2735 2876 # Sites Locations 3 927 1056 9 132 198 2418 3867 Cac8I 40 CjeI 24 CjePI 18 ClaI 2 402 4119 CviJI 84 CviRI 22 DdeI 11 DpnI 23 DraIII 1 5129 DrdI 3 2919 3334 DrdII 2 848 5134 DsaI 3 212 562 EaeI 4 166 433 EagI 1 166 EarI 3 743 3110 EciI 3 902 3300 Eco47III 3 530 2031 Eco57I 1 3774 EcoNI 2 660 4340 EcoO109I 3 53 558 EcoRI 1 192 EcoRII 10 229 848 3252 3373 EcoRV 1 206 FauI 17 FokI 9 1171 1180 2771 2912 FspI 1 2207 GdiII 4 166 433 HaeI 6 853 2174 4515 HaeII 14 HaeIII 23 HgaI 11 HgiEII 2 723 3812 HhaI 46 Hin4I 4 203 1024 HincII 2 181 1631 HindIII 1 173 HinfI 18 HpaI 1 1631 HphI 16 KpnI 1 238 MaeII 14 MaeIII 16 MboII 12 MluI 1 1125 MmeI 7 3441 3625 4635 5106 MnlI 25 MseI 25 MslI 6 1177 1465 2799 MspI 29 MspA1I 9 84 283 2817 2936 MwoI 39 NarI 4 448 469 NciI 12 NcoI 1 212 NdeI 1 295 NgoAIV 4 435 2023 NlaIII 26 NlaIV 24 NotI 1 166 NruI 1 4085 NsiI 2 4278 4544 NspI 4 600 2571 NspV 1 268 Enzyme BstXI BstYI 1179 241 3878 689 4677 1901 Enzyme P?1108I P?MI PleI PshAI Psp5II Psp1406I PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II UbaJI VspI XbaI XcmI XhoI XmnI # Sites 1 3 9 1 1 4 1 3 3 4 1 1 1 14 23 22 23 4 1 1 1 1 2 2 17 6 9 36 25 7 21 1 8 18 5 1 3 1 2 Locations 2012 260 707 382 674 3605 4660 1970 2232 787 2155 4428 1725 1818 523 3946 236 1272 190 179 3110 4691 761 5064 1557 5072

TB076 12/98

3120

2551 2817 4821 3032

4914

625 3540

1109

2220

4263

5084 2198 565 4241 3446 2480

1400

4041

4225

1799

2141

2232

2511

447 1894 523 1984

468 2020 1336 2344

582 5166 4083

2232 1163 3386 1703 4316 1760 4673

367 4428 444 4302 600 4353 57 1033 5033 1804 4339

3491

3682

5348

4921 212 1251 2106 4395 1924 2276 4567 3128 2780 4658 4682 3201

2109 1612 1417 2837

3317 3728 1451

3615 4747 1951

2445 4066 565 3241

2507 4672 1799 3252

2585

3704

1306 4575 2971 964 3855 382 333 981 158 2784

2134 5302

2665

2878

2973

2086

2753

1657 4264 1810 1497 4817

2687 4391 1869 1515

3816

3823

4114

4656

4627

4816

2423 583 1947

1082 2415

1765 3432

2386 3142 3566 4428

4070

4264

4626

Enzymes that do not cut pET-29a(+): AatII A?II AgeI AscI BsaI BseRI BspMI BsrGI DraI Eam1105I FseI MscI NheI PacI PmeI PmlI RleAI RsrII SacII ScaI S?I SnaBI SpeI SrfI StuI SunI SwaI

AvrII Bsu36I MunI PstI SexAI Sse8387I

1353 4444 2497 966 3751

1740

2867

1495

2213

2408

5344 998 3897 1268 3929

1155 3568 583

1725 3813 1765

1818

2183

5230

4827 811

5273 2023 2183

2863

3230

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-30 Ek/LIC Vector

TB162 12/98 The pET-30 Ek/LIC vector is prepared for rapid, directional cloning of PCR-ampli?ed DNA for high-level expression of polypeptides. Using speci?cally designed primers for ampli?cation and the pET-30 Ek/LIC Cloning Kit (Cat. No. 69077-3), inserts can be ef?ciently cloned without the need for restriction digestion or ligation. Fusion proteins contain N-terminal cleavable His?Tag? and S?Tag? sequences for detection and puri?cation. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circle map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single stranded DNA that corresponds to the coding strand. Therefore, single stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-30 Ek/LIC sequence landmarks

T7 promoter T7 transcription start His?Tag coding sequence S?Tag coding sequence Multiple cloning sites (BseR I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

436-452 435 344-361 266-310 158-224 140-157 26-72 843-1922 3356 4065-4877 4973-5428

Bpu1102 I(80) Dra III(5197)

Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) EcoR V(206) Nco I(211) Srf I(230) BseR I(234) Kpn I(255) Bgl II(258) Nsp V(285) Nde I(363) Xba I(401)

kan ( 406 5-4 87 7)

Note: the Srf I site is destroyed during Ligation Independent Cloning. Primer sequence extensions required for LIC compatibility are underlined in the diagram below.

f1
Pvu I(4496) Sgf I(4496)

3-5428) (497 gin ori

SgrA I(512) Sph I(668)

Mlu I(1193) Bcl I(1207) BstE II(1374) Apa I(1404)

lacI (843-1922)

Nru I(4153)
5'GACGACGACAAGATG...sense..TAACCGGGCTTCTCCTC 3' 3'CTGCTGCTGTTCTAC...anti...ATTGGCCCGAAGAGGAG 5'
T4 DNA pol + dATP
start insert stop

pET-30 Ek/LIC
(5439bp)

Eco57 I(3842) AlwN I(3710)

BssH II(1604) Hpa I(1699)

GACGACGACAAGATG...sense..TAA AC...anti...ATTGGCCCGAAGAGGAG

or

+
GAT CTACTGCTGCTGTTCT CCGGGCTTCTCCTCA T

(3

i

BssS I(3467)

35

6)

PshA I(2038) Bgl I(2257) Fsp I(2275) Psp5 II(2300)

Ek/LIC vector
Ek/LIC overhangs

BspLU11 I(3294) Sap I(3178) Bst1107 I(3065) Tth111 I(3039)

T7 promoter primer #69348-3 pET upstream primer #69214-3 T7 promoter lac operator

AGATCGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACATATGCACCATCATCATCATCATTCTTCTGGTCTGGTGCCACGCGGTTCTGGTATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCCCAGATCTG MetHisHisHisHisHisHisSerSerGlyLeuValProArgGlySerGlyMetLysGluThrAlaAlaAlaLysPheGluArgGlnHisMetAspSerProAspLeu
LIC site

Xba I

rbs S?Tag primer #69945-3 Nsp V

Nde I

His?Tag

S?Tag

Bgl II

GGTACCGATGACGACGACAAGAGCCCGGGCTTCTCCTCAACCATGGCGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAG GlyThrAspAspAspAspLysSerProGlyPheSerSerThrMetAlaIleSerAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGlu
enterokinase His?Tag

Kpn I

Srf I

BseR I

thrombin Nco I EcoR V BamH I EcoR I Sac I

Sal I

Hind III

Eag I Not I

Xho I

Bpu1102 I

T7 terminator

CACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTA HisHisHisHisHisHisEnd AACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-30 Ek/LIC cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-30 Ek/LIC Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 3064 7 960 1688 3246 5037 AciI 75 A?III 2 1193 3294 AluI 22 AlwI 13 Alw21I 7 159 190 3112 3612 Alw44I 3 1173 3108 AlwNI 1 3710 ApaI 1 1404 ApaBI 1 877 ApoI 7 192 287 4999 5010 AvaI 3 158 228 AvaII 5 1745 2121 BamHI 1 198 BanI 10 251 327 1113 1832 BanII 7 190 235 4151 5272 BbsI 4 1339 1678 BbvI 25 BccI 14 Bce83I 6 21 2007 3924 BcefI 6 712 1053 5223 BcgI 8 160 194 2053 2871 BclI 1 1207 BfaI 6 70 402 5348 BglI 1 2257 BglII 1 258 BmgI 1 1402 BpmI 4 1031 1520 Bpu10I 2 2400 4513 Bpu1102I 1 80 BsaAI 2 3046 5197 BsaBI 3 466 476 BsaHI 5 516 537 BsaJI 11 BsaWI 7 2 1512 3647 4631 BsaXI 2 1852 5145 BsbI 2 3010 5104 BscGI 11 BseRI 1 234 BsgI 3 1044 1244 BsiI 1 3467 BsiEI 5 169 1978 BslI 26 BsmI 2 4380 4457 BsmAI 6 890 1295 4512 BsmBI 3 1808 2935 BsmFI 4 654 2195 BsoFI 43 Bsp24I 10 483 515 1368 3787 Bsp1286I 13 BspEI 2 2 2483 BspGI 1 2820 BspLU11I 1 3294 BsrI 21 BsrBI 4 422 3227 BsrDI 2 1240 1606 BsrFI 7 503 512 4450 5298 BssHII 1 1604 2019 2803 2944 Enzyme Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraIII DrdI DrdII DsaI EaeI EagI EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI KpnI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I 1336 3997 MwoI NarI NciI NcoI NdeI NgoAIV NlaIII NlaIV NotI NruI NsiI # Sites 1 1 3 9 40 24 18 2 85 23 11 23 1 3 2 3 4 1 3 3 3 1 2 3 1 9 1 17 9 1 4 6 14 23 11 2 46 4 2 1 18 1 16 1 14 16 13 1 7 26 25 6 30 9 39 4 14 1 1 4 26 23 1 1 2 Locations 3065 1374 995 1124 132 198 2486 3935 1247 258 3946 Enzyme NspI NspV P?1108I P?MI PleI PshAI Psp5II Psp1406I PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SrfI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II 4182 4724 UbaJI VspI XbaI XcmI XhoI XmnI # Sites 4 1 1 3 9 1 1 4 1 3 3 4 1 1 1 14 23 23 23 4 1 1 2 1 1 2 2 17 6 9 36 25 7 21 1 8 18 5 1 3 1 2 Locations 668 2639 285 2080 277 775 450 742 3673 4728 2038 2300 855 2223 4496 1793 1886 591 4014 253 1340 190 179 3178 2931 3298

TB162 12/98

757 4745

1969

4759 829 5132

1625 5140

3188

693 3608

1177

2288

470

4187

2619 2885 4889 3100

4982

4331

1468 4368 2209 515 1962 577 2052

4109

4293

2300 536 2088 591 2412

2579 650 5234 1404

2177 1680 1485 2905 2308

3385 3796 1519

3683 4815 2019

5197 2987 916 211 166 166 811 970 598 3842 728 53 192 916 3441 206 1239 2839 2275 166 921 4583

3402 5202 630 501 3178 3368 2099 4408 626 1231 3454

5152 2266 633 4309 3514 2548

1867

2300 1771 4384 1828 4741 3320

435 4496 512 230 668 230 4421 57 1101 5101 1872 4407

3559

3750

5416

4370

4989 211 1319 2174 4463 1992 2344 4635 3196 2848 4726 4750 3269

1248 2980 501 2242

2513 4134 633 3309

2575 4740 1867 3320

2653

3789

4096

3772

1374 4643 3039 1032 3923 450 401 1049 158 2852

2202 5370

2733

2946

3041

2154

2821

791 203 181 173 1699 255

3880 1092 1699

1725 4332 1878 1565 4885

2755 4459 1937 1583

3884

3891

2491 651 2015

1150 2483

1833 3500

4695

4884

2454 3210 3634 4496

1193 3509 4703

3693 5174

4138

4332

4694

1421 4512 2565 1034 3819

1808

2935

Enzymes that do not cut pET-30 Ek/LIC: AatII A?II AgeI AscI BaeI BsaI BspMI BsrGI DraI Eam1105I FseI MscI NheI PacI PmeI PmlI RleAI RsrII SacII ScaI S?I SnaBI SpeI Sse8387I SunI SwaI

AvrII Bsu36I MunI PstI SexAI StuI

1245 2867 84 2885 516 211 363 503

1533

1563

2281

2476

5412 1066 3965

300 3004 537

1223 3636 651

1793 3881 1833

1886

2091

2251

5298

4895 879

5341 2091 2251

166 4153 4346

4612

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-30 Xa/LIC Vector

TB185 12/98 The pET-30 Xa/LIC vector is designed for rapid, directional cloning of PCR-ampli?ed DNA for high-level expression of polypeptides containing N-terminal His?Tag? and S?Tag? sequences for detection and puri?cation. Using speci?cally designed primers for ampli?cation and the pET-30 Xa/LIC Vector Kit (Cat. No. 69073-3), inserts can be ef?ciently cloned without the need for restriction digestion or ligation, and the resulting fusion proteins can be cleaved with Factor Xa to precisely remove all vector-encoded amino acids. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circle map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single stranded DNA that corresponds to the coding strand. Therefore, single stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-30 Xa/LIC sequence landmarks

T7 promoter T7 transcription start His?Tag coding sequence S?Tag coding sequence Multiple cloning sites (BseR I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

445-463 444 353-370 275-319 158-225 140-157 26-72 852-1931 3365 4074-4886 4982-5437

Dra III(5206)

Bpu1102 I(80)

Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) EcoR V(206) Nco I(211) Msc I(216) BseR I(235) PinA I(257) Kpn I(264) Bgl II(267) Nsp V(294) Nde I(372) Xba I(410) SgrA I(521) Sph I(677)

Pvu I(4505) Sgf I(4505) Sma I(4379)

kan ( 407 4-4 88 6)

Primer sequence extensions required for Xa/LIC compatibility are underlined in the diagram below.

5437) 4982in ( rig o f1

Mlu I(1202) Bcl I(1216) BstE II(1383) Apa I(1413)

lacI (852-1931)

Nru I(4162)
start Met (or any) stop (or read through)

pET-30 Xa/LIC
(5448bp)
Eco57 I(3851) AlwN I(3719)

5'GGTATTGAGGGTCGCATG...sense..TAAGGCTCTAACTCTCCTCT 3' 3'CCATAACTCCCAGCGTAC...anti...ATTCCGAGATTGAGAGGAGA 5'
T4 DNA pol + dGTP

insert

BssH II(1613)

or

GGTATTGAGGGTCGCATG...sense..TAAGG GCGTAC...anti...ATTCCGAGATTGAGAGGAGA

33

i(

BssS I(3476)

65

)
PshA I(2047) Bgl I(2266) Fsp I(2284) Psp5 II(2309)

+
TCC AGGCCATAACTCCCA CTCTAACTCTCCTCT

BspLU11 I(3303) Sap I(3187) Bst11107 I(3074) Tth111 I(3048)

Xa/LIC vector
Xa/LIC overhangs

T7 promoter primer #69348-3 pET upstream primer #69214-3 T7 promoter lac operator

AGATCGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I
His?Tag S?Tag S?Tag primer #69945-3 Nsp V

Xba I

rbs

Bgl II

TATACATATGCACCATCATCATCATCATTCTTCTGGTCTGGTGCCACGCGGTTCTGGTATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCCCAGATCTG ????????????∏????? ‰???? ?‰??????∏??
LIC site

Kpn I PinA I

GGTACCGGTGGTGGCTCCGGTATTGAGGGTCGCTCTAACTCTCCTCTGGCCATGGCGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAG ????????‰?????∏???????∏?????? ?????‰
Factor Xa His?Tag

thrombin BseR I Msc I Nco I EcoR V BamH I EcoR I Sac I

Sal I

Hind III

Eag I Not I

Xho I

Bpu1102 I

T7 terminator

CACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTA ??????End AACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-30 Xa/LIC cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-30 Xa/LIC Restriction Sites
Enzyme AccI AciI A?III AluI AlwI Alw26I AlwNI ApaI ApaLI ApoI AvaI AvaII BamHI BanI BanII BbsI BbvI BcgI BcgI’ BclI BfaI BglI BglII BpmI Bpu10I Bpu1102I BsaAI BsaBI BsaHI BsaJI BsaWI BseRI BsgI BsiEI BsiHKAI BslI BsmI BsmBI BsmFI Bsp1286I BspEI BspLU11I BsrI BsrBI BsrDI BsrFI BssHII BssSI Bst1107I BstEII BstXI BstYI Cac8I ClaI CviJI DdeI DpnI DraIII DrdI DsaI EaeI EagI # Sites 2 75 2 22 13 6 1 1 3 7 2 5 1 10 6 4 25 4 4 1 6 1 1 4 2 1 2 3 5 10 9 1 3 5 7 26 2 3 4 12 2 1 21 4 2 8 1 1 1 1 3 9 40 2 85 11 23 1 3 3 5 1 Locations 180 3073 1202 3303 Enzyme EarI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI Fnu4HI FokI FspI HaeII HaeIII HgaI HhaI HincII HindIII HinfI HpaI HphI KpnI MaeIII MboII MluI MnlI MscI MseI MslI MspI MspA1I MwoI NarI NciI NcoI NdeI NgoAIV NlaIII NlaIV NotI NruI NsiI NspI NspV P?MI PinAI PleI PshAI Psp1406I Psp5II PvuI PvuII RcaI RsaI SacI SalI SapI Sau3AI Sau96I ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SspI # Sites 3 3 1 2 3 1 9 1 17 43 9 1 14 24 11 46 2 1 18 1 16 1 16 13 1 27 1 25 6 31 9 39 4 12 1 1 4 26 24 1 1 2 4 1 3 1 9 1 4 1 1 3 3 4 1 1 1 23 14 21 23 4 1 1 1 1 2 Locations 820 3187 607 2108 3851 737 4417 53 635 192 925 1240 3450 3463 206 4318 2557 Enzyme StyI TaiI TaqI T?I ThaI TseI Tsp45I Tsp509I TspRI Tth111I VspI XbaI XcmI XhoI XmnI # Sites Locations 2 57 211 14 17 9 1881 2183 4416 4472 36 25 7 1383 2211 4652 5379 21 13 1 3048 5 459 1887 1 410 3 1058 1574 1 158 2 2861 4894

TB185 12/98

2309 1780 4393 1837 4750 3329

2353 4644

2857 4735

3278

899 4521 3719 1413 1182 192 5008 158 1754 198 260 1122 190 5281 1348 194 160 1216 70 5357 2266 267 1040 2409 80 3055 475 525 57 2275 2 2492 235 1053 169 159 3121 4389 1817 663 2 3303 431 1249 257 2260 1613 3476 3074 1383 1004 132 2495 479

1304

1430

1817

2944

2742

2955

3050

3117 296 5019 4377 2130 336 1841 586 1687 1494 1528 411

3617 1477

4118

4302

2218 524 1971 600 2061 2062 2028 2317

2309 545 2097 1413 2421 2914 2880 3798

2588 659 5243 4160

1248 2848 2284

1257 2989

2522 4143

2584 4749

2662

1946 1592

4704

4893

181 173 1708 264

1708

4105

Enzymes that do not cut pET-30 Xa/LIC: AatII A?II AhdI AscI BsaI BspMI BsrGI Bsu36I FseI MunI NheI PacI PmlI PstI RsrII SacII ScaI SexAI S?I SnaBI SrfI Sse8387I StuI SunI UbaEI

AvrII DraI PmeI SanDI SpeI SwaI

1202 216 1254 2876 84 2894 525 211 372 512 1542 1572 2290 2485

1529 4522 5206 485 546 211 3463 245 3509 1253 1987 190 3621 4466 2944 2204 2492

2163

2830

2500 660 639 4376 257 3656 2463 3219 702

1159 645 4377 1521 4640

1842 1837 4778 2024

309 3013 546

1232 3645 660

1802 3890 1842

1895

3643 1186

4505 2297

2100

2260

5307

4521 2574

5421

3236 1615 512 4459

4904 521 5307

5350 888 2100

1133 198 3944 4196

1256 267 3955

766 4754

1978

166 4162 4355 677 294 286 257 459 3682 2047 864 2309 4505 1802 600 262 190 179 3187

4621 2648 784 751 4737 2232

2940 4768 838 5141 2628

3307

1634 5149 4991

3197

1895 4023 1349

2894 4898 3109

4340

5206 2996 211 166 166

3411 639 214

5161 2275 510

642

1876

444 4505 521 4379 677 4430

3568

3759

5425

4998

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-30a-c(+) Vectors
pET-30a DNA pET-30b DNA pET-30c DNA Cat. No. 69909-3 69910-3 69911-3

TB095 12/98 The pET-30a-c(+) vectors carry an N-terminal His?Tag?/thrombin/S?Tag?/enterokinase con?guration plus an optional C-terminal His?Tag sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-30a(+) sequence landmarks

Pvu I(4479) Sgf I(4479) Sma I(4353)

The maps for pET-30b(+) and pET-30c(+) are the same as pET-30a(+) (shown) with the following exceptions: pET-30b(+) is a 5421bp plasmid; subtract 1bp from each site beyond BamH I at 198. pET-30c(+) is a 5423bp plasmid; add 1bp to each site beyond BamH I at 198.

kan ( 404 8-4 86 0)

T7 promoter T7 transcription start His?Tag coding sequence S?Tag coding sequence Multiple cloning sites (Nco I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin Kan coding sequence f1 origin

419-435 418 327-344 249-293 158-217 140-157 26-72 826-1905 3339 4048-4860 4956-5411
Dra III(5180)

Xho I(158) Not I(166) Eag I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) EcoR V(206) Nco I(212) Kpn I(238) Bgl II(241) Bpu1102 I(80) Nsp V(268) Nde I(346) Xba I(384) SgrA I(495) Sph I(651)

5411) 4956in ( rig o f1

Mlu I(1176) Bcl I(1190) BstE II(1357) Apa I(1387)

lacI (826-1905)

Nru I(4136)

pET-30a(+)
(5422bp)
Eco57 I(3825) AlwN I(3693)

BssH II(1587) Hpa I(1682)

or
BssS I(3450)

(3

BspLU11 I(3277) Sap I(3161) Bst1107 I(3048) Tth111 I(3022)

i

33

9)

PshA I(2021) Bgl I(2240) Fsp I(2258) Psp5 II(2283)

T7 promoter primer #69348-3 pET upstream primer #69214-3 T7 promoter lac operator

AGATCGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I
His?Tag S?Tag Nsp V

Xba I

rbs

Bgl II

TATACATATGCACCATCATCATCATCATTCTTCTGGTCTGGTGCCACGCGGTTCTGGTATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCCCAGATCTG MetHisHisHisHisHisHisSerSerGlyLeuValProArgGlySerGlyMetLysGluThrAlaAlaAlaLysPheGluArgGlnHisMetAspSerProAspLeu
Kpn I
pET-30a(+)

GGTACCGACGACGACGACAAGGCCATGGCTGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAA GlyThrAspAspAspAspLysAlaMetAlaAspIleGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeuArgSerGlyCysEnd
enterokinase pET-30b(+) pET-30c(+)

Nco I

thrombin EcoR V BamH I EcoR I Sac I Sal I Hind III

Eag I Not I

Xho I

His?Tag

...GCGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA... AlaIleSerAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd ...GGATATCTGTGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAA... ...GlyTyrLeuTrpIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGluIleArgLeuLeu...
Bpu1102 I
T7 terminator primer #69337-3 T7 terminator

CAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-30a-c(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-30a(+) Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 3047 7 943 1671 3229 5020 AciI 75 A?III 2 1176 3277 AluI 22 AlwI 13 Alw21I 7 159 190 3095 3595 Alw44I 3 1156 3091 AlwNI 1 3693 ApaI 1 1387 ApaBI 1 860 ApoI 7 192 270 4982 4993 AvaI 2 158 4351 AvaII 5 1728 2104 BamHI 1 198 BanI 10 234 310 1096 1815 BanII 6 190 560 5255 BbsI 4 1322 1661 BbvI 25 BccI 14 Bce83I 6 21 1990 3907 BcefI 6 695 1036 5206 BcgI 8 160 194 2036 2854 BclI 1 1190 BfaI 6 70 385 5331 BglI 1 2240 BglII 1 241 BmgI 1 1385 BpmI 4 1014 1503 Bpu10I 2 2383 4496 Bpu1102I 1 80 BsaAI 2 3029 5180 BsaBI 3 449 459 BsaHI 5 499 520 BsaJI 10 57 212 2249 3437 BsaWI 7 2 1495 3630 4614 BsaXI 2 1835 5128 BsbI 2 2993 5087 BscGI 11 BsgI 3 1027 1227 BsiI 1 3450 BsiEI 5 169 1961 BslI 26 BsmI 2 4363 4440 BsmAI 6 873 1278 4495 BsmBI 3 1791 2918 BsmFI 4 637 2178 BsoFI 43 Bsp24I 10 466 498 1351 3770 Bsp1286I 12 BspEI 2 2 2466 BspGI 1 2803 BspLU11I 1 3277 BsrI 21 BsrBI 4 405 3210 BsrDI 2 1223 1589 BsrFI 7 486 495 4433 5281 BssHII 1 1587 2002 2786 2927 Enzyme Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraIII DrdI DrdII DsaI EaeI EagI EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI KpnI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I 1319 3980 MwoI NarI NciI NcoI NdeI NgoAIV NlaIII NlaIV NotI NruI NsiI # Sites 1 1 3 9 40 24 18 2 85 31 11 23 1 3 2 3 4 1 3 3 3 1 2 3 1 9 1 17 9 1 4 7 14 24 11 2 46 4 2 1 18 1 16 1 14 16 13 1 7 25 25 6 29 9 39 4 12 1 1 4 26 23 1 1 2 Locations 3048 1357 978 1107 132 198 2469 3918 1230 241 3929 Enzyme NspI NspV P?1108I P?MI PleI PshAI Psp5II Psp1406I PvuI PvuII RcaI RsaI SacI SalI SapI Sau96I Sau3AI ScrFI SfaNI SfcI SgfI SgrAI SmaI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I Tsp509I Tth111I Tth111II 774 203 181 173 1682 238 3863 1075 1682 4165 4707 UbaJI VspI XbaI XcmI XhoI XmnI 18 5 1 3 1 2 # Sites 4 1 1 3 9 1 1 4 1 3 3 4 1 1 1 14 23 21 23 4 1 1 1 1 2 2 17 6 9 36 25 7 21 1 8 Locations 651 2622 268 2063 260 758 433 725 3656 4711 2021 2283 838 2206 4479 1776 1869 574 3997 236 1323 190 179 3161 2914 3281

TB095 12/98

740 4728

1952

4742 812 5115

1608 5123

3171

676 3591

1160

2271

453

4170

2602 2868 4872 3083

4965

4314

1451

4092

4276

2192 498 1945 574 2035

2283 519 2071 1387 2395

2562 633 5217 4134

2160 1663 1468 2888 2291

3368 3779 1502

3666 4798 2002

5180 2970 899 212 166 166 794 953 581 3825 711 53 192 899 3424 206 1222 2822 2258 166 217 3755

3385 5185 613 484 3161 3351 2082 4391 609 1214 3437

5135 2249 616 4292 3497 2531

1850

2283 1754 4367 1811 4724 3303

418 4479 495 4353 651 4404 57 1084 5084 1855 4390

3542

3733

5399

4972 212 1302 2157 4446 1975 2327 4618 3179 2831 4709 4733 3252

1231 2963 484 904 4566

2496 4117 616 2225

2558 4723 1850 3292

2636

3772

4079

3303

1357 4626 3022 1015 3906 433 384 1032 158 2835

2185 5353

2716

2929

3024

2137

2804

1708 4315 1861 1548 4868

2738 4442 1920 1566

3867

3874

2474 634 613 4350 1998

4678

4867

1133 619 4351 2466

1816 1811 4752 3483

2437 3193 3617 4479

1176 3492 4686

3676 5157

4121

4315

4677

Enzymes that do not cut pET-30a(+): AatII A?II AgeI AscI BaeI BsaI BseRI BspMI Bsu36I DraI Eam1105I FseI MunI NheI PacI PmeI PstI RleAI RsrII SacII SexAI S?I SnaBI SpeI Sse8387I StuI SunI SwaI

AvrII BsrGI MscI PmlI ScaI SrfI

1404 4495 2548 1017 3802

1791

2918

1228 2850 84 2868 499 212 346 486

1516

1546

2264

2459

5395 1049 3948

283 2987 520

1206 3619 634

1776 3864 1816

1869

2074

2234

5281

4878 862

5324 2074 2234

166 4136 4329

4595

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-31b(+) Vector

TB098 12/98 The pET-31b(+) vector (Cat. No. 69952-3) is designed for cloning and high-level expression of peptide sequences fused with the 125aa ketosteroid isomerase protein (1). The unique AlwN I cloning site allows the unidirectional insertion of of tandemly repeated peptide coding regions separated by methionine codons. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).
1. Kuliopulos, A. and Walsh, C.T. (1994) J. Am. Chem. Soc. 116, 4599–4607.

pET-31b(+) sequence landmarks

T7 promoter T7 transcription start KSI coding sequence AlwN I site His?Tag? coding sequence T7 terminator lacI coding sequence pBR322 origin bla coding sequence f1 origin

616-632 615 170-544 169 140-157 26-72 1019-2098 3532 4287-5144 5276-5731
Sca I(4837) Pvu I(4727) Pst I(4602)
Ap (4 287 -51 44 )

Sty I(57) Bpu1102 I(80)

Ava I(158) Xho I(158) AlwN I(169)

Dra III(5500)

Cla I(249)

279-5734) in (5 orig f1

Nde I(543) Nsi I(543) Xba I(581) Bgl II(647) SgrA I(688) Sph I(844) EcoN I(904) PflM I(951) ApaB I(1053)

KSI (17 0-5 44 )

Bsa I(4418)
Eam1105 I(4357)–

pET-31b(+)
(5742bp)

Mlu I(1369) Bcl I(1383) BstE II(1550) Bmg I(1578) Apa I(1580) BssH II(1780) EcoR V(1819) Hpa I(1875) Hinc II(1875)

lacI (1019-209 8)

BspLU11 I(3470) Sap I(3354) Bst1107 I(3241) Acc I(3240) Tth111 I(3215)

or

(3

i

53

2)

PshA I(2214) Psp5 II(2476) Bpu10 I(2576)

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACATATG...105aa...GGCAAGGTGGTGAGCATCCGCGCCTTGTTTGGCGAGAAGAATATTCACGCATGCCAGATGCTGCTCGAGCACCACCACCACCACCACTGA Met...315bp...GlyLysValValSerIleArgAlaLeuPheGlyGluLysAsnIleHisAlaCysGlnMetLeuLeuGluHisHisHisHisHisHisEnd GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

Bgl II

T7 promoter

lac operator

Xba I

rbs

Nsi I Nde I

KSI primer #69947-3

KSI

AlwN I

Ava I Xho I

His?Tag?

Bpu1102 I

T7 terminator

pET-31b(+) cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-31b(+) Restriction Sites
Enzyme AccI AciI A?III AluI AlwI Alw21I AlwNI ApaI ApaBI ApaLI ApoI AvaI AvaII BanI BanII BbsI BbvI BccI Bce83I BcefI BcgI BclI BfaI BglI BglII BmgI BpmI Bpu10I Bpu1102I BsaI BsaAI BsaBI BsaHI BsaJI BsaWI BsaXI BsbI BscGI BsiI BsiEI BslI BsmAI BsmBI BsmFI BsoFI Bsp24I Bsp1286I BspEI BspGI BspLU11I BsrI BsrBI BsrDI BsrFI BssHII Bst1107I BstEII BstXI # Sites 1 84 2 26 14 8 1 1 1 4 3 1 8 10 5 5 28 14 7 8 8 1 7 2 1 1 5 1 1 1 2 3 8 10 8 2 2 14 2 6 22 7 2 4 48 10 13 2 2 1 24 4 4 9 1 1 1 3 Locations 3240 1369 3470 Enzyme BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraI DraIII DrdI DrdII DsaI EaeI Eam1105I EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HinfI HpaI HphI MaeII MaeIII MboII MluI MmeI MnlI MseI MslI MspI MspA1I MwoI NarI NciI NdeI NgoAIV NlaIII NlaIV NsiI NspI P?1108I P?MI PleI # Sites 11 40 28 20 1 89 25 11 28 3 1 4 2 5 4 1 3 4 4 2 1 3 8 1 17 11 2 4 5 16 25 14 2 52 4 1 15 1 19 15 18 16 1 3 27 28 10 34 10 46 5 12 1 6 25 26 1 5 1 2 9 Locations Enzyme RcaI RsaI SapI Sau96I Sau3AI ScaI ScrFI SfaNI SfcI SgrAI SphI SspI StyI TaqI TaqII T?I ThaI TseI Tsp45I 1947 2004 Tsp509I Tth111I Tth111II UbaJI VspI XbaI XcmI XhoI XmnI # Sites Locations 3 767 4184 6 332 403 4837 1 3354 20 28 1 4837 20 23 5 615 3735 1 688 2 177 844 3 184 5161 1 57 13 9 1277 1495 4890 5043 6 391 2048 3445 38 28 8 1550 2378 4613 4824 15 1 3215 8 212 470 4054 4061 20 4 630 2054 1 58 3 1225 1741 1 158 2 3028 4956 5192 512 1516

TB098 12/98

3276

249

159 3788 169 1580 1053 1349 1644 158 407 2755 227 2008 417 424

869 4943

1353 5028

2464

3288

3284 5302 1921 4495 691 2138 753 1515

3784 5313 2297 4717 712 2264 767 1854

5024

2385 826 4305 1580 2228

2476 1289 5537 5575 2588

21 4094 385 1856 1661 3081 1383 70 4547 2433 647 1578 1207 2576 80 4418 3222 646 228 1326 57 806 2 3676 2028 3186 3643 325 4876 1066 4418 1984 830 659 1544 2 475 3470 602 1416 224 2267 1780 3241 1550 1171

2183 4962 456 3966 1695 4862 582 5651 4477

2353 532 5526 2195 4896 2484

3561 888 2229

3859 1229 3047

4223 5500 470 1092 424 677 4357 987 1146 507 4012 904 53 409 3496 1819

4242 3163 5505 439 809 3354 3544 774 5024 802 1092 3617

4934 3578 514 2043 5152 3690 2275 5455 806 4745 2442

3920

4598

5719

5292

4512 2724

2168 5060 2350

3372 5404 2520

4705 3024

2476 1407 3630

2909 5673

3122

3217

1208 4093 2113 1759

1901

2931

3959

4212

2451 677 1097

4579 809 2418

2043 3485

4745 3496

4529

3942

1696

2330

2997

4427

967 412 1875 1875

4050 1268 4356 4430 Enzymes that do not cut pET-31b(+): AatII A?II AgeI AscI BaeI BamHI BseRI BsmI BsrGI Bsu36I EagI EcoRI HindIII KpnI MunI NcoI NotI NruI NspV PacI PmlI RleAI RsrII SacI SalI SexAI S?I SgfI SnaBI SpeI SrfI Sse8387I SunI SwaI AvrII BspMI FseI NheI PmeI SacII SmaI StuI

5500 652 444 2009 410 812 404 3823 5448 5407 5021 2154

2667 692 4894 424 2004 1688 4648

713 439 2442 2191

827 514 3630 2659

1369 3685

3869

5477

519 2652

1421 3043

1709 4609

1739 4768

2457 5127

3386

3810

4727

1471 5194 3111 2371 691 3957 2659 2996

1597

1984

3111

228 543 224 5601

692

713

827

2009

2741 1210 3989

5715 1242 4135 1512 4167

482

679

2267

2427

3403 1782 482 2427

5198 4418 679 4437

5644 4592 688 5601

1055

PshAI 1 Psp5II 1 Psp1406I 6 PstI PvuI PvuII 1 1 4

1300

1423

543 177 951 395 630 3849 2214 2476 1031 5285 4602 4727 1969

844 569 918 4346

2815

3107

3474

1005 5435

1801 5443

3364

2399

2795

4583

4956

2062

3061

3880

Novagen ? FAX 608-238-1388 ? E-MAIL novatech@novagen.com

pET-32 Ek/LIC Vector

TB161 12/98 The pET-32 Ek/LIC vector is prepared for rapid, directional cloning of PCR-ampli?ed DNA for high-level expression of polypeptides fused with the 109aa Trx?Tag? thioredoxin protein (1). Using speci?cally designed primers for ampli?cation and the pET-32 Ek/LIC Cloning Kit (Cat. No. 69076-3), inserts can be ef?ciently cloned without the need for restriction digestion or ligation. Fusion proteins also contain cleavable His?Tag? and S?Tag? sequences for detection and puri?cation. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circle map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single stranded DNA that corresponds to the coding strand. Therefore, single stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3).

pET-32 Ek/LIC sequence landmarks

T7 promoter T7 transcription start Trx?Tag coding sequence His?Tag coding sequence S?Tag coding sequence Multiple cloning sites (BseR I - Xho I) His?Tag coding sequence T7 terminator lacI coding sequence pBR322 origin bla coding sequence f1 origin

781-797 780 383-709 344-361 266-310 158-224 140-157 26-72 1188-2267 3701 4462-5319 5451-5906

1. LaVallie, E.R., DiBlasio, E.A., Kovacic, S., Grant, K.L., Schendel, P.F. and McCoy, J.M. (1993) Bio/Technology 11, 187–193.
Bpu1102 I(80) Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) EcoR V(206) Nco I(211) Sma I(230) Srf I(230) BseR I(234) Kpn I(255) Bgl II(258) Nsp V(285) Msc I(368) Rsr II(606)

Dra III(5675)

Pvu I(4902) Pst I(4777)

Ap (4 462 -53 19 )

Notes: the Srf I and Sma I sites are destroyed during Ligation Independent Cloning. Primer sequence extensions required for LIC compatibility are underlined in the diagram below.

-5906) (5451 gin ori f1
Sca I(5012)

trxA (38 370

Xba I(746) SgrA I(857) Sph I(1013) EcoN I(1073)

9)

Bsa I(4593) Ahd I(4532)
5'GACGACGACAAGATG...sense..TAACCGGGCTTCTCCTC 3' 3'CTGCTGCTGTTCTAC...anti...ATTGGCCCGAAGAGGAG 5'
T4 DNA pol + dATP
start insert stop

pET-32 Ek/LIC
(5917bp)

lacI (1188 -22 67 )

Mlu I(1538) Bcl I(1552) BstE II(1719) Apa I(1749) BssH II(1949)

GACGACGACAAGATG...sense..TAA AC...anti...ATTGGCCCGAAGAGGAG

AlwN I(4055)

or

+
GAT CTACTGCTGCTGTTCT CCGGGCTTCTCCTCA T

Ek/LIC vector
Ek/LIC overhangs

BspLU11 I(3639) Sap I(3523) Bst1107 I(3410) Tth111 I(3384)

i(

70

3

1)

Hpa I(2044)

PshA I(2383) Psp5 II(2645) Bpu10 I(2745)

pET upstream primer #69214-3 T7 promoter lac operator Trx?Tag primer #69031-3 Msc I

TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Trx?Tag His?Tag

Xba I

rbs

TATACATATGAGC...315bp...CTGGCCGGTTCTGGTTCTGGCCATATGCACCATCATCATCATCATTCTTCTGGTCTGGTGCCACGCGGTTCT MetSer 105aa...LeuAlaGlySerGlySerGlyHisMetHisHisHisHisHisHisSerSerGlyLeuValProArgGlySer
S?Tag S?Tag primer #69945-3 Nsp V LIC site

GGTATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCCCAGATCTGGGTACCGATGACGACGACAAGAGCCCGGGCTTCTCCTCAACCATG GlyMetLysGluThrAlaAlaAlaLysPheGluArgGlnHisMetAspSerProAspLeuGlyThrAspAspAspAspLysSerProGlyPheSerSerThrMet
EcoR V BamH I EcoR I Sac I Sal I Hind III Eag I Not I Xho I
His?Tag enterokinase

Bgl II

Kpn I

thrombin Sma I Srf I

BseR I

Nco I

GCGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAA AlaIleSerAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd CAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

Bpu1102 I

T7 terminator

pET-32 Ek/LIC cloning/expression region
Novagen ? ORDERING 800-526-7319 ?
TECHNICAL SUPPORT

800-207-0144

pET-32 Ek/LIC Restriction Sites
Enzyme AccI AceIII # Sites Locations 2 180 3409 8 1305 2033 3591 4831 AciI 85 A?III 2 1538 3639 AluI 25 AlwI 17 Alw21I 10 159 190 2633 3457 Alw44I 5 427 1518 AlwNI 1 4055 ApaI 1 1749 ApaBI 1 1222 ApoI 5 192 287 AvaI 2 158 228 AvaII 8 606 2090 2924 4670 BamHI 1 198 BanI 11 BanII 6 190 235 5750 BbsI 4 1684 2023 BbvI 29 BccI 14 Bce83I 7 21 2352 4269 5137 BcefI 5 1057 1398 BcgI 14 BclI 1 1552 BfaI 7 70 747 4722 5826 BglI 2 2602 4652 BglII 1 258 BmgI 1 1747 BpmI 5 1376 1865 Bpu10I 1 2745 Bpu1102I 1 80 BsaI 1 4593 BsaAI 2 3391 5675 BsaBI 3 811 821 BsaHI 6 861 882 5069 BsaJI 10 57 211 975 981 BsaWI 7 2 1857 3992 4823 BsaXI 2 2197 5623 BsbI 2 3355 5582 BscGI 14 BseRI 1 234 BsgI 3 1389 1589 BsiI 2 3812 5196 BsiEI 6 169 2323 5051 BslI 25 BsmAI 7 1235 1640 4593 5369 BsmBI 2 2153 3280 BsmFI 4 999 2540 BsoFI 50 Bsp24I 10 828 860 1713 4132 Bsp1286I 15 BspEI 2 2 2828 BspGI 1 3165 BspLU11I 1 3639 BsrI 25 BsrBI 4 767 3572 BsrDI 4 1585 1951 BsrFI 8 380 848 2596 4612 BssHII 1 1949 2364 5515 3148 3289 Enzyme Bst1107I BstEII BstXI BstYI Cac8I CjeI CjePI ClaI CviJI CviRI DdeI DpnI DraI DraIII DrdI DrdII DsaI EaeI EagI Eam1105I EarI EciI Eco47III Eco57I EcoNI EcoO109I EcoRI EcoRII EcoRV FauI FokI FspI GdiII HaeI HaeII HaeIII HgaI HgiEII HhaI Hin4I HincII HindIII HinfI HpaI HphI KpnI MaeII MaeIII MboII MluI MmeI MnlI MscI MseI MslI MspI MspA1I MwoI NarI NciI NcoI NdeI NgoAIV NlaIII NlaIV NotI # Sites 1 1 3 12 39 26 18 2 90 28 11 32 3 1 3 3 4 7 1 1 3 4 3 2 1 3 1 9 1 17 13 2 6 6 14 26 13 3 46 4 2 1 16 1 18 1 15 18 15 1 3 29 1 28 9 33 10 41 4 14 1 2 4 26 27 1 Locations 3410 1719 1340 1469 1592 Enzyme NspI NspV P?1108I P?MI PleI # Sites 4 1 2 2 10 Locations 1013 2984 285 2425 4550 277 1120 483 795 3533 4018 2383 2645 1200 2568 5460 4777 4902 2138 2231 936 4359 253 659 606 190 179 3523 3276 3643

TB161 12/98

1087

相关文章:
PET计算方法和公式
PET计算方法和公式_能源/化工_工程科技_专业资料。PU 资料 聚氨酯计算公式中有关术语及计算方法 1. 官能度 官能度是指有机化合物结构中反映出特殊性质(即反应活性...
PET
PET_化学_自然科学_专业资料。聚对苯二甲酸乙二醇酯(PET) 简介聚对苯二甲酸乙二醇酯, 英文名 polyethylene terephthalate(简称 PET) 别名:聚对苯二甲酸乙二酯;...
PET分类词汇
长沙发 Page 1 of 5 学而思教育 PET 分类词汇 microwave 微波炉 path 小路 roof 屋顶 neat 整齐的 peaceful 和平的 antique 古玩;古董 armchair 扶手椅 carpet ...
PET-CT成像技术的原理及其应用
PET-CT成像技术的原理及其应用_能源/化工_工程科技_专业资料。详细叙述PET联用CT技术的生物医学成像技术。PET-CT 成像技术的原理及其应用 摘要:本文主要介绍了正电子...
CT、MRI、PET三种检查的比较
CT、MRI、PET三种检查的比较_基础医学_医药卫生_专业资料。CT、MRI、PET三种检查的比较CT 、 MRI 、 PET 三种检查的比较 CT(X 线电子计算机断层扫描 ) 主要是...
PET的生产工艺及流程图
工艺控制略解 聚对苯二甲酸乙二酯(PET)吹塑瓶的生产按型坯的预成型不同可分为注射拉伸吹 塑(简称注拉吹)和挤出拉伸吹塑(简称挤拉吹)。在这两种成型方法中,...
PET材料
PET材料_材料科学_工程科技_专业资料。什么是 PET ?PET 材料的特性, PET 材料的优点 PET 属于环保材料。 PET 塑料是英文 Polyethylene terephthalate 的缩写,简称 ...
PET与SBS的对比_图文
PET 自粘防水卷材与SBS防水材料的比较防水材料对比表 PET 自粘聚合物改性沥青防水卷材 SBS 改性沥青防水卷材 防水机理 PET 自粘防水卷材,具有与聚合物水泥(砂) 浆...
PET简介
PET简介_化学_自然科学_专业资料。PET基础知识PET 简介 塑料是指以树脂等高分子化合物为基本成分与配料混合后加热、 加压而成的具有一定的 形状的材料。聚对苯二甲...
荧光机理
1 光致电子转移(PET) 光致电子转移是指电子给体或电子受体受光激发后, 激发态的电子给体与电 子受体之间发生电子转移从而导致荧光的淬灭过程。具体 PET 过程如...
更多相关标签: