当前位置:首页 >> 医药卫生 >>

Vaccination of ducks with recombinant outer membrane protein of Riemerella anatipestifer


Veterinary Microbiology 84 (2002) 219–230

Vaccination of ducks with recombinant outer membrane protein (OmpA) and a 41 kDa partial protein (P45N0) of Riemerella anatipestifer
Bin Huanga, Sumathi Subramaniama, Joachim Freyc, Hilda Lohd, Hai-Meng Tana,b, Charlene J. Fernandezd, Jimmy Kwanga, Kim-Lee Chuaa,e,*
a

Institute of Molecular Agrobiology, National University of Singapore, Singapore, Singapore b Department of Microbiology, National University of Singapore, Singapore, Singapore c Institute for Veterinary Bacteriology, University of Bern, CH-3012 Bern, Switzerland d Veterinary Laboratory Branch, Central Veterinary Laboratory, Singapore, Singapore e Department of Biochemistry, Faculty of Medicine, National University of Singapore, 10 Kent Ridge Crescent, 119260 Singapore, Singapore

Received 8 May 2001; received in revised form 13 August 2001; accepted 5 September 2001

Abstract The generation of protective immunity against Riemerella anatipestifer infection in ducks were investigated by immunizations with recombinant glutathione sulfatransferase (GST) fusion’s proteins of OmpA, a 42 kDa major outer membrane protein, and P45N0 , a 41 kDa N-terminal fragment of a newly identi?ed 45 kDa potential surface protein from R. anatipestifer. The DNA encoding OmpA and P45N0 were isolated from R. anatipestifer serotype 15 (?eld strain 110/89) and serotype 19 (reference strain 30/90), respectively. Immunoblotting and ELISA results showed that the puri?ed recombinant proteins induced the production of antibodies in immunized ducks. However, neither was protective against subsequent challenge with the virulent serotype 15 strain, 34/90. All the ?ve ducks immunized with formalinized R. anatipestiferstrain 34/90 survived the challenge with the homologous strain whereas six out of seven ducks in the non-immunized control group died within a week following the challenge. # 2002 Elsevier Science B.V. All rights reserved.
Keywords: Duck; Riemerella anatipestifer; Vaccination

* Corresponding author. Tel.: ?65-8743684; fax: ?65-7791453. E-mail address: bchckl@nus.edu.sg (K.-L. Chua).

0378-1135/02/$ – see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 1 3 5 ( 0 1 ) 0 0 4 5 6 - 4

220

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

1. Introduction Riemerella anatipestifer, a gram-negative, non-motile and non-spore forming rod shaped bacterium, is the aetiological agent of a contagious septicemic disease in domestic ducks, turkeys and various other birds (Hendrickson and Hilbert, 1932; Asplin, 1955; Segers et al., 1993). Based on 16S rRNA gene sequence analyses, it belongs to the family Flavobacteriaceae in rRNA superfamily V (Subramaniam et al., 1997). The disease causes a serious problem in the duck industry worldwide due to high mortality, weight loss and condemnations (Leibovitz, 1972; Leibovitz and Sandhu, 1976; Helfer and Helmboldt, 1977; Tripathy, 1983). Twenty-one serotypes of R. anatipestifer have been identi?ed but serotypes 1, 10 and 15 have been responsible for most of the major outbreaks in Singapore, Thailand, UK and Denmark (Bisgaard, 1982; Timms and Marshall, 1989; Sandhu and Leister, 1991; Loh et al., 1992; Pathanosophon et al., 1995; Pathanasphon et al., 1996). The occurrence of more than one R. anatipestifer serotype in infected ducks at any one time and changes in serotypes from year to year within a single farm have been observed (Teo et al., 1992). Signi?cant variations in virulence, as assessed by mortality and morbidity rates in outbreaks, have been reported for the different serotypes of R. anatipestifer. In addition, differences in virulence were also observed within a given serotype (Brogden, 1989). Several attempts have been made to immunize ducks against R. anatipestifer infection using inactivated bacterins, live or cell-free culture ?ltrate vaccines (Sandhu, 1979; Layton and Sandhu, 1984; Timms and Marshall, 1989; Sandhu and Leister, 1991; Teo et al., 1992; Pathanasphon et al., 1996). However, no signi?cant cross-protection was reported. Little progress has been made towards developing a subunit vaccine against R. anatipestifer and only the outer membrane protein gene, ompA, has been characterized to date (Subramaniam et al., 2000). Outer membrane proteins play an important role in virulence and induce strong antibody responses (Puohiniemi et al., 1990; Weiser and Gotschlich, 1991) that are bactericidal, opsonic or protective (Murphy et al., 1998; Wedege et al., 1998; Brunham and Zhang, 1999; Luke et al., 1999). Outer membrane proteins are therefore suitable candidate proteins for vaccine development. R. anatipestifer produces a 42 kDa OmpA which is found in the ATCC type strain and in reference serotypes and ?eld strains (Subramaniam et al., 2000). During the characterization of a large genomic clone from serotype 19 strain 30/90 which expressed the Christie Atkins and Muench-Paterson (CAMP) co-hemolytic activity, a 1130 bp sequence encoding the N-terminal fragment (P45N0 ) of a 45 kDa potential surface protein (P45), was identi?ed. Although P45 was not the CAMP factor, its translated amino acid sequence predicted an antigenic protein and its DNA was detected in the R. anatipestifer ATCC type strain and all the reference serotypes tested. In this study, we investigate the immunogenicity and protective ef?cacy of recombinant OmpA and P45N0 proteins. 2. Materials and methods 2.1. Bacterial strains, cloning vectors, growth conditions and bacterin preparation The strain type, serotype reference strains (Loh et al., 1992) and ?eld isolates used in this study are listed in Table 1. The highly virulent serotype 15 strain 34/90, was chosen as the

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230 Table 1 Riemerella anatipestifer strains used in this study Strain no. ATCC11845 HPRS1795c HPRS2521c HPRS2554c HPRS2565c HPRS2550c CVL389/82c DRL27179c DRL26220c HPRS1785c CCUG25055-890822c CVL664/83c CVL743/85c CVL110/89d CVL34/90d DRLS-4801c CVL977/83c CVL540/89c CVL30/90c
a a

221

Serotype ND 1 2 3 4 5 6 7 8 9 11 14 15 15 15 16 17 18 19
b

Source American Type Culture Collection Houghton Poultry Research Station, UK Houghton Poultry Research Station, UK Houghton Poultry Research Station, UK Houghton Poultry Research Station, UK Houghton Poultry Research Station, UK Central Veterinary Laboratory, Singapore Duck Research Laboratory, New York, USA Duck Research Laboratory, New York, USA Houghton Poultry Research Station, UK ¨ Culture Collection, University of Goteborg, Sweden Central Veterinary Laboratory, Singapore Central Veterinary Laboratory, Singapore Central Veterinary Laboratory, Singapore Central Veterinary Laboratory, Singapore Duck Research Laboratory, New York, USA Central Veterinary Laboratory, Singapore Central Veterinary Laboratory, Singapore Central Veterinary Laboratory, Singapore

Strain type. ND: not determined. c Serotype reference strain. d Field strain.
b

challenge strain. All strains were cultured for 24 h on trypticase soy agar at 37 8C in air enriched with 5% CO2. Escherichia coli strain BL21 (DE3) (E. coli B F? dcm omp T hsdS (rB? mB?) gal l (DE3 T7pd) (Stratagene, La Jolla, CA, USA) was used for transforming pGEX-5X-1 recombinant plasmids (Amersham Pharmacia Biotech AB, Uppsala, Sweden). E. coli was cultured in Luria Bertani (LB) broth and transformants were selected on media supplemented with 100 mg/ml ampicillin. Optimal expression of recombinant proteins was achieved by the addition of isopropyl-b-D-thiogalactopyranoside (IPTG) to a ?nal concentration of 1 mM during the mid-exponential growth phase for a 4 h duration. For bacterin preparation, a single colony of each strain was inoculated into trypticase soy broth and incubated in a shaker at 37 8C overnight. This culture was then adjusted to an OD525 ? 2 with trypticase soy broth. Formaldehyde was added to a ?nal concentration of 0.4% (v/v) to inactivate the bacterial cells and the formalinized product incubated with stirring at 37 8C for 2 h and then overnight at room temperature (Teo et al., 1992). 2.2. Polymerase chain reaction The DNA sequences encoding OmpA and P45N0 were cloned separately into pGEX-5X-1 by polymerase chain reaction (PCR) ampli?cation of the DNA sequences with genespeci?c primers containing appropriate restriction enzyme sites. The primers used for PCR

222

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

ampli?cation and cloning of ompA were: HBompABHI-L (cgcgggatccCGATGGGTAAAGAATTTATGTTG) and HBompAX/R (ccgctcgagTTTTCTTTTCTTTTTTACTAC), whilst those for p45N0 were HBp45/L (gccggaattcATGGTACTTATAAAGATGCTTAAAAAC) and HBp45/R (ccgctcgagTTATCTACTATATATGTTCCGTTC). The PCR reactions were carried out in a DNA thermal cycler (GeneAmp 9600; Perkin-Elmer Applied Biosystems, Foster City, CA, USA) in 50 ml reaction mix (10 mM Tris–HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 170 mM of each dNTP, 20 pmol of each primer, 200 ng genomic DNA and 2.5 U Taq/Pfu polymerase mix (ExpandTM High Fidelity PCR System, Boehringer, Mannheim, Germany). The PCR thermal parameters used were 35 cycles of ampli?cation with 30 s at 94 8C, 30 s at an annealing temperature of 48 8C for ompA and 57 8C for p41, and 2 min at 72 8C. An additional extension step of 7 min at 72 8C was included at the end of the last cycle to ensure full-length synthesis of the different fragments. 2.3. DNA sequence analysis Recombinant pGEX-5X-1 plasmids were sequenced using AmpliTaq FS dye terminator kit (Perkin-Elmer Corp., Norwalk, CT, USA) in reactions containing approximately 500 ng plasmid DNA and 5 pmol of forward (GGGCTGGCAAGCCACGTTTGGTG) and reverse (CCGGGAGCTGCATGTGTCAGAGG) oligonucleotide primers. Sequence contigs were assembled and edited by using the Sequencher 3.0 program (GeneCodes, Ann Arbor, MI, USA). Homology searches of the nucleotide sequences were performed using the BLASTN and BLASTX (Altschul et al., 1990). The DNA and amino acid sequences were analyzed using SWISSPROT. 2.4. Purification of recombinant proteins and plasmids Recombinant proteins from IPTG induced cultures were sequentially extracted in lysis buffer (50 mM Tris, pH 8.0, 0.3 M NaCl, 0.5 mM EDTA, 0.5% Tween 20) containing 1, 6 and 8 M urea and 1.3% SDS, respectively. Twenty milliliter of lysis buffer was added to the pellet of 1 l of induced culture. After the cells were twice disrupted by ultrasonic treatment for 30 s at Speed 3 using a Sonicator1 ultrasonic processor (Misonix Inc., Farmingdale, NY, USA) and cooling for 15 min at room temperature with intermittent mixing, the lysate centrifuged at 14,000 ? g for 20 min. The supernatant was collected and the pellet sequentially resuspended in 12 ml of lysis buffer containing increased concentrations of urea and, ?nally, in 1.3% SDS. The process of sonication, incubation and centrifugation was repeated and the supernatant collected each time. Optimal conditions for solubilization and the purity of the recombinant proteins were ascertained using SDS-PAGE and Coomassie blue staining and immunoblotting using protein speci?c polyclonal duck sera, respectively. 2.5. Production of antisera and immunological methods Monospeci?c polyclonal antisera directed against the glutathione sulfatransferase (GST) fusion proteins, rGST-OmpA and rGST-P45N0 , were obtained by immunization of 4-week-old speci?c pathogen free (SPF) ducks acquired from the Agri-food Veterinary

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

223

Authority of Singapore. Ducks were subcutaneously immunized with 500 mg (in 0.5 ml) recombinant proteins mixed with equal volume of Seppic Montanide ISA 733 adjuvant (Paris Cedex, France). After 2 and 4 weeks, respectively, the ducks were boosted using the same dosage of recombinant proteins. The blood samples were collected from the wing vein 2 weeks after the second booster and the sera separated from the blood clot after refrigerating the blood overnight. Western blots of puri?ed rGST-OmpA and rGST-P45N0 , and total cell lysates were performed as described by Ausubel et al., 1990, using 1:100 dilution of duck sera. Bound antibodies were detected using 1:500 dilution of horseradish peroxidase conjugated goat anti-duck IgG (Kirkegaard and Perry Laboratory Inc., Gaithersburg, MD, USA). Optimal concentrations of puri?ed rGST-OmpA and rGTP45N0 , conjugates and serum dilutions for ELISA were determined by titration. For the ELISA, we added 50 ng (100 ml) of rGST-OmpA or rGST-P45N0 protein, diluted with 0.1 M sodium bicarbonate buffer (pH 9.6), to each well of a 96-well microtiter plates (Microtiter1 Styrene Immunoassay Plate, DYNEX Technologies Inc., Chantilly, VA, USA). The plates were coated at 4 8C, overnight, washed ?ve times with PBS containing 0.05% Tween 20 (PBST20, pH 7.4), and blocked with 1% BSA in PBS for 1 h at 37 8C. Following several washes in PBST20, 100 ml of 1:200 dilution of each duck serum from ?eld samples was added to each well. One negative and one positive control were included in each plate. After incubation for 10 min at 37 8C and several washes, 100 ml of 1:1000 dilution of secondary antibody was added. After another 10 min incubation at 37 8C, and several washes, 100 ml of o-phenylenediamine dihydrochloride (Sigma, St. Louis, MI, USA) substrate solution was added. The plates were incubated for 10 min at room temperature and the color development stopped on adding 25 ml of 4 M H2SO4. The OD490 readings were obtained using Elx808 ultra microplate reader (BIO-TEK, Instruments Inc.,Winooski, VT, USA). All samples were analyzed in duplicate. The ELISA results were expressed as P:N ratio (ODtested sample:ODnegative control). A P:N ratio of >2 is regarded as positive. 2.6. Immunization and challenge A total of 54 1-day-old SPF ducklings were acquired from the Agri-Food Veterinary Authority of Singapore. Ducks were subcutaneously immunized with 0.5 ml formalinized bacterin or 0.5 ml recombinant protein (1 mg/ml) in equal volume of Seppic Montanide ISA 773 adjuvant on day 7 and day 14, respectively. Ducklings were challenged by subcutaneous injections in the leg with a 2 ml inoculum (2:5 ? 109 cfu/ml) of the serotype 15 strain 34/90 on day 24. Before challenge, sera were collected from ducklings to detect the antibodies using ELISA. Mortality was recorded for 10 days post challenge and ducklings were necropzied and organs cultured for R. anatipestifer. Isolates were serotyped by speci?c antiserum to identify the serotype (Loh et al., 1992). 2.7. Nucleotide sequence GenBank accession numbers The GenBank accession numbers of the R. anatipestifer ompA gene cloned from serotype 15 strain 110/89 is AF104936, and that of the 1130 bp DNA fragment encoding the partial P45 protein cloned from R. anatipestifer serotype 19 strain 30/90 is AF317801.

224

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

3. Results 3.1. Expression and purification of recombinant OmpA and P45N0 The DNA sequences encoding the R. anatipestifer OmpA and P45N0 antigens were ampli?ed using oligonucleotide primers HBompABHI-L and HBompAX/R for ompA, and HBp45/L and HBp45/R for p45N0 , using genomic DNA of R. anatipestifer serotype 15 strain 110/89 and serotype 19 reference strain 30/90, respectively. P45N0 is an N-terminal fragment of one of the three ORFs in a genomic clone from serotype 19 strain 30/90 which showed positive CAMP co-hemolytic activity (Christie et al., 1944). P45N0 was not responsible for the CAMP activity but its translated amino acid sequence showed high antigenicity as determined by the Jameson–Wolfson plot, as well as four peaks of high surface probability according to the Emini surface probability prediction using Protean (DNASTAR Inc., Madison, WI, USA; data not shown). The puri?ed PCR products for ompAand p45N0 were cloned into pGEX-5X-1 for the expression of fusion proteins, rGSTOmpA and rGST-P45N0 . The orientation and sequence of the inserts were veri?ed by DNA sequence analysis using primers ?anking the insert on the vector as well as internal primers. Both rGST-OmpA and rGST-P45N0 were expressed as insoluble proteins and optimal solubilization was achieved in lysis buffer containing 6 M urea (data not shown). The apparent molecular masses of rGST-OmpA and rGST-P45N0 calculated from SDS-PAGE were 69 and 68 kDa, respectively. The GST moiety contributed 27 kDa towards the overall masses of the fusion proteins. The immunoreactivities of rGST-OmpA and rGST-P45N0 were tested using sera from ducks which were infected with R. anatipestifer (Fig. 1). Total cell lysates of R. anatipestiferserotype 15 strain CVL110/89 reacted with monospeci?c polyclonal anti-OmpA hyperimmune serum detected a dominant band of about 55 kDa, besides a few weakly immunoreactive bands (data not shown). Puri?ed rGST-OmpA reacted with convalescent sera from ducks experimentally immunized with R. anatipestiferserotype 15 strain CVL110/89 detected a band of 69 kDa corresponding to the size of rGST-OmpA (data not shown). The immunoreactivity of P45N0 was similarly tested. Total cell lysate of R. anatipestifer serotype 19 reference strain CVL30/90 reacted with monospeci?c polyclonal anti-P45N0 serum to yield a 45 kDa band (Fig. 1B). Puri?ed rGST-P45N0 protein also reacted with sera from ducks experimentally immunized with R. anatipestifer serotype 19 strain CVL30/90 to yield a band of 68 kDa (Fig. 1A). In both cases, neither total cell lysates nor the recombinant proteins reacted with sera from SPF ducks. 3.2. Occurrence of p45 in R. anatipestifer strains PCR ampli?cation of genomic DNA from R. anatipestifer type strain (ATCC11845) and serotype reference strains using the primers RAADH6 (50 GGTTAAACTCAATAGCTTTG30 ) and JFRA8R11 (50 ATGTTCCGTTCATAGACATTTGCC-30 ) produced a band of approximately 1.2 kb in all the R. anatipestifer strains tested, showing that the DNA encoding P45N0 is widely distributed amongst the different R. anatipestiferserotypes (data not shown). The strains tested represented serotypes 1, 2, 3,4, 5, 6, 7, 8, 9, 11, 14, 15, 16, 17, 18 and 19, as well as the ATCC11845 strain. The occurrence and expression

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

225

Fig. 1. Detection of antibodies to P45N0 by western blot analysis. Panel A shows the results of recombinant GST-P45N0 protein reacting with sera from ducks experimentally immunized with formalinized bacteria of R. anatipestifer serotype 19 strain CVL30/90. Panel B shows the results of total cell lysate of R. anatipestifer serotype 19 strain CVL30/90 reacting with sera from ducks immunized using rGST-P45N0 . Lane 1: prestained protein marker (New England BioLabs); Lane 2: negative control sera from SPF ducks; Lane 3a: positive sera from ducks immunized using formalinized bacteria of R. anatipestifer serotype 19 strain CVL30/90; Lane 3b: positive sera from ducks immunized with recombinant GST-P45N0 protein. Serum dilution used in the western blots was 1:100.

of ompA in R. anatipestifer strains has been described previously (Subramaniam et al., 2000). 3.3. Response to challenge infection Table 2 summarizes the mortality of ducklings given two subcutaneous injections of bacterin and recombinant proteins to the foot and subsequently challenged with serotype 15 strain 34/90 10 days after the last vaccination. Ducks immunized with strain 34/90 bacterin were protected against subsequent challenge with the homologous strain. None of the ducks in this group died (group 2). However, immunization with bacterins prepared from heterologous strains failed to provide cross protection. All six ducks in group 3 died even though both the R. anatipestifer strains used for the immunization 110/89, and the challenge strain 34/90, belonged to serotype 15. Sevety-?ve percent mortality was also recorded for the ducks in group 4 which were immunized with a bacterin prepared from a serotype 19 strain, 30/90. The recombinant proteins also did not provide any protection against subsequent challenge with R. anatipestiferserotype 15 strain 34/90. All the ducks immunized with rGST-OmpA (group 5) died upon challenge with strain

226

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

Table 2 Mortality of ducks when challenged with a virulent R. anatipestifer strain CVL34/90 Group Immunization no. 1 2 3 4 5 6
a

No. of No. of deaths (days after challenge) No. of death Mortality ducks (total) (%) 1 2 3 4 5 6 7 8 9 10 0 0 0 0 0 0 2 0 1 1 4 1 3 0 2 2 2 5 0 0 1 0 – 0 0 0 1 0 – 0 0 0 0 0 – 0 1 0 1 0 – 0 0 0 –a 0 – 0 0 0 – 0 – 0 0 0 – 0 – 0 6 0 6 3 6 6 (7) (5) (6) (4) (6) (7) 85.7 0 100 75 100 85.7

None 7 Formalinized bacteria (34/90) 5 Formalinized bacteria (110/89) 6 Formalinized bacteria (30/90) 4 rGST-OmpA 6 rGST-P45N0 7 (–) indicates that all the ducks had died.

34/90 whilst 85.7% mortality was recorded in ducks from group 6 which were immunized with rGST-P45N0 . 3.4. Serological responses The immune responses of ducks in the various experimental groups were determined using an ELISA using rGST-OmpA and rGST-P45N0 as antigens (Table 3). Sera from SPF ducks reacted with rGST-OmpA and rGST-P45N0 to give OD490 values of 0:079 ? 0:020 (N ? 27) and 0:068 ? 0:019 (N ? 27), respectively. These served as negative control values (N) for the respective assays. Sera from the ducks immunized with bacterins and recombinant proteins mostly gave P:N ratios >2 when reacted with rGST-OmpA and rGSTP45N0 , thus con?rming the presence of speci?c antibodies to R. anatipestifer. Hence, despite the lack of protection following immunization with formalinized strains 110/89 and

Table 3 Detection of specific antibodies in ducks immunized with bacterins, rGST-OmpA and rGST-P45N0 Group A Control Formalinized bacteria (34/90) Formalinized bacteria (110/89) Formalinized bacteria (30/90) rGST-OmpA Group B Control Formalinized bacteria (34/90) Formalinized bacteria (110/89) Formalinized bacateria (30/90) rGST-P45N0
a

No. of ducks 2 5 5 4 6 No. of ducks 2 5 5 4 6

P:N ratiosa obtained with rGST-OmpA antigen 1.582, 1.645 2.842, 12.297, 7.785, 8.247, 9.278 2.747, 4.848, 3.240, 3.177, 2.386 3.715, 2.487, 3.582, 2.380 16.557, 12.120, 5.500, 21.570, 3.867, 23.949 P:N ratiosa obtained with rGST-P45N0 antigen 0.962, 1.037 1.541, 5.674, 3.985, 2.933, 6.222 2.356, 2.267, 1.807, 2.089, 2.585 2.992, 4.696, 2.141, 1.467 18.689, 3.704, 2.407, 18.118, 16.030, 2.341

No. of positive (total) 0 5 5 4 6 (2) (5) (5) (4) (6)

No. of positive (total) 0 4 4 3 6 (2) (5) (5) (4) (6)

Mean absorbance of duplicate test wells (P) as a fraction of mean absorbance of negative control value.

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

227

30/90, and recombinant proteins, these antigens were ef?cient at eliciting speci?c antibody production. 3.5. Histopathology Ducks that died following challenge were subjected to postmortem examination. The sections examined generally showed moderately diffuse chronic active periportal hepatitis with random single cell hepatocellular necrosis, Kupffer cell hyperplasia and ?brinous serositis in the liver. The heart exhibited severe coalescing to diffuse dissecting chronic active and ?brinous epicarditis and myocarditis with myo?ber degeneration and loss (data not shown). Bacterial isolation on TSA plates from the affected organs detected R. anatipestifer serotype 15 by slide agglutination tests (Loh et al., 1992). In control ducks that were killed and examined, there was no signi?cant pathology of the heart and liver (data not shown).

4. Discussion The structural and functional roles of OmpA and P45 proteins of R. anatipestifer are unknown. Outer membrane proteins are generally very immunogenic and play important roles in the virulence and immunity of bacterial diseases (Weiser and Gotschlich, 1991; Prasadarao et al., 1996; Vogt and Schulz, 1999). P45 is an immunogenic and potential surface protein with low (25%) amino acid sequence identital to a reovirus attachment protein sigma 1. The purpose of this study was to investigate the protective capacities of a newly identi?ed protein, P45N0 , and the outer membrane protein, OmpA of R. anatipestifer. As expected, ducks immunized with formalinized R. anatipestifer serotype 15 strain 34/ 90 were fully protected when challenged with the homologous strain. However, immunization of the ducks with bacterin prepared from another serotype 15 strain 110/89, did not confer any protection when challenged with strain 34/90. Similarly, ducks immunized with bacterin prepared from a different serotype, serotype 19 strain 30/90, did not protect the ducks when challenged with the strain 34/90. It has been reported that bacterins protect poorly against challenge by heterologous strains of R. anatipestifer (Layton and Sandhu, 1984; Sandhu and Leister, 1991). In our study, this is also seen in the group immunized with serotype 19 strain 30/90. Immunization with bacterin prepared from strain 110/89 which, like the challenge strain 34/90, belonged to serotype 15 and did not provide any protection during the challenge. This con?rmed an absolute requirement for bacterins prepared from a homologous strain for vaccination in order to achieve maximal protection against this disease. Neither the rGST-OmpA or rGST-P45N0 antigens were useful as vaccines against R. anatipestiferinfections. In each case, mortalities of 85.7–100% were recorded. The lack of protection of these antigens against subsequent challenge by R. anatipestifer serotype 15 strain 34/90 was not due to their inability to mount a speci?c immune response. The ELISA successfully detected the production of antibodies against these recombinant proteins in ducks, immunized using the rGST-OmpA and rGST-P45N0 . To be protective, antibodies

228

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

function as opsonins and/or trigger complement activation generating other opsonins and membrane-attack complexes. The lack of protection after immunization with recombinant proteins of OmpA and P45N0 despite the production of antibodies in ducks may be due to (i) the inability of the recombinant proteins to elicit antibodies speci?c for the native proteins, or (ii) the organism presenting a capsule that prevents access to epitopes on the protein, or (iii) the absence of both OmpA and P45 proteins on the surface of R. anatipestifer, or (iv) ineffective protection by a single protein or subunit vaccination and a combination of several kinds of proteins may be necessary. In Pasteurella multocida, the outer membrane protein (Oma87) fragment of serotype D was also expressed as a recombinant GST fusion protein and tested as a vaccine against P. multocida infections in chickens. Although this recombinant protein reacted with convalescent sera from chickens infected with P. multocida, it failed to protect chickens against challenge with a virulent P. multocida serotype A (Mitchison et al., 2000). Sera from ducks immunized with formalinized bacteria were reactive against recombinant OmpA and P45N0 proteins in ELISA. Therefore, we conclude that both OmpA and P45 are present in R. anatipestifer strains 110/89, 34/90 and 30/90 and that the two recombinant proteins and their native forms possess some epitopes in common. Our study established the protective capacity of homologous strain vaccination against R. anatipestifer and con?rmed the ineffectiveness of heterologous preparations. For this reason, some common proteins present in all serotypes may serve as candidates for subunit vaccine preparations. We utilized OmpA and P45, which were found in different serotypes of R. anatipestifer, but neither provided an effective protection. Further efforts to identify protective antigens giving rise to the different serotypes may identify candidates which would be suitable as subunit vaccines against R. anatipestifer infection of ducks and poultry.

Acknowledgements We thank Thiam-Peng Teo, Central Veterinary Laboratory, Agri-Food Veterinary Authority of Singapore, for his technical assistance with challenge infection experiments. We also thank Wei Liu, Dennis Seah and Li Yu for their help in obtaining the sera from ducks. This work is supported by funds from the National Science and Technology Board, and is an extension of the Swiss Asia Foundation collaborative programme between the Institute of Molecular Agrobiology, Singapore and the Institute for Veterinary Bacteriology, University of Bern, Switzerland. B. Huang was a recipient of a graduate research scholarship from the National University of Singapore. References
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Asplin, F.D., 1955. A septicaemic disease of ducklings. Vet. Rec. 67, 854–858. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1990. Current Protocols in Molecular Biology, Wiley.

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

229

Bisgaard, M., 1982. Isolation and characterization of some previously unreported taxa from poultry with phenotypical characters related to Actinobacillus and Pasteurella species. Acta Pathol. Microbiol. Immunol. Scand. B 90, 59–67. Brogden, K.A., 1989. Pasteurella anatipestifer infection. In: Adlam, C., Rutter, J.M. (Eds.), Pasteurella and Pasteurellosis. Academic Press, London, pp. 115–129. Brunham, R.C., Zhang, D., 1999. Transgene as vaccine for chlamydia. Am. Heart J. 138, S519–522. Christie, R., Atkins, N.E., Muench-Petersen, E., 1944. A note on lytic phenomenon shown by group B Strepococci. Aust. J. Exp. Biol. Med. Sci. 22, 197–199. Helfer, D.H., Helmboldt, C.F., 1977. Pasteurella anatipestifer infection in turkeys. Avian Dis. 21, 712–715. Hendrickson, J.M., Hilbert, K.F., 1932. A new and serious septicaemic disease of young ducks with a description of the causative organism, Pfeiferella anatipestifer. N S Cornell Vet. 22, 239–252. Layton, H.W., Sandhu, T.S., 1984. Protection of ducklings with a broth-grown Pasteurella anatipestifer bacterin. Avian Dis. 28, 718–726. Leibovitz, L., 1972. A survey of the so-called anatipestifer syndrome. Avian Dis. 16, 836–851. Leibovitz, L., Sandhu, T., 1976. A review of the economically important diseases of domestic ducks, In: Proceedings of the 20th World Veterinary Congress, Thessaloniki, Greece, Vol. 3, pp. 2337–2341. Loh, H., Teo, T.P., Tan, H.-C., 1992. Serotypes of Pasteurella anatipestifer isolates from ducks in Singapore: a proposal of new serotypes. Avian Pathol. 21, 453–459. Luke, N.R., Russo, T.A., Luther, N., Campagnari, A.A., 1999. Use of an isogenic mutant constructed in Moraxella catarrhalis To identify a protective epitope of outer membrane protein B1 defined by monoclonal antibody 11C6. Infect. Immun. 67, 681–687. Mitchison, M., Wei, L., Kwang, J., Wilkie, I., Adler, B., 2000. Overexpression and immunogenicity of the Oma87 outer membrane protein of Pasteurella multocida. Vet. Microbiol. 72, 91–96. Murphy, T.F., Kyd, J.M., John, A., Kirkham, C., Cripps, A.W., 1998. Enhancement of pulmonary clearance of Moraxella (Branhamella) catarrhalis following immunization with outer membrane protein CD in a mouse model. J. Infect. Dis. 178, 1667–1675. Pathanasphon, P., Sawada, T., Pramoolsinsap, T., Tanticharoenyos, T., 1996. Immunogenicity of Riemerella anatipestifer broth culture bacterin and cell-free culture filtrate in ducks. Avian Pathol. 25, 705–719. Pathanosophon, P., Sawada, T., Tanticharoenyos, T., 1995. New serotypes of Riemerella antipestifer isolated from ducks in Thailand. Avian Pathol. 24, 195–199. Prasadarao, N.V., Wass, C.A., Weiser, J.N., Stins, M.F., Huang, S.H., Kim, K.S., 1996. Outer membrane protein A of Escherichia coli contributes to invasion of brain microvascular endothelial cells. Infect. Immun. 64, 146–153. Puohiniemi, R., Karvonen, M., Vuopio-Varkila, J., Muotiala, A., Helander, I.M., Sarvas, M., 1990. A strong antibody response to the periplasmic C-terminal domain of the OmpA protein of Escherichia coli is produced by immunization with purified OmpA or with whole E. coli or Salmonella typhimurium bacteria. Infect. Immun. 58, 1691–1696. Sandhu, T.S., 1979. Immunization of white Pekin ducklings against Pasteurella anatipestifer infection. Avian Dis. 23, 662–669. Sandhu, T.S., Leister, M.L., 1991. Serotypes of Pasteurella anatipestifer isolated from poultry in different countries. Avian Pathol. 20, 233–239. Segers, P., Mannheim, W., Vancanneyt, M., De Brandt, K., Hinz, K.H., Kersters, K., Vandamme, P., 1993. Riemerella anatipestifer gen. nov., comb. nov., the causative agent of septicemia anserum exsudativa, and its phylogenetic affiliation within the Flavobacterium-Cytophaga rRNA homology group. Int. J. Sys. Bacteriol. 43, 768–776. Subramaniam, S., Chua, K.L., Tan, H.M., Loh, H., Kuhnert, P., Frey, J., 1997. Phylogenetic position of Riemerella anatipestifer based on 16S rRNA gene sequences. Int. J. Sys. Bacteriol. 47, 562–565. Subramaniam, S., Huang, B., Loh, H., Kwang, J., Tan, H.M., Chua, K.L., Frey, J., 2000. Characterization of a predominant immunogenic outer membrane protein of Riemerella anatipestifer. Clin. Diagn. Lab. Immunol. 7, 168–174. Teo, T.P., Tan, H.C., Loh, H., 1992. Protective efficacy of a bivalent Pasteurella anatipestifer broth-grown bacterin in ducklings. Singapore J. Prim. Ind. 20, 53–60. Timms, L.M., Marshall, R.N., 1989. Laboratory assessment of protection given by experimental Pasterurella anatipestifer vaccine. Bri. Vet. J. 145, 483–493.

230

B. Huang et al. / Veterinary Microbiology 84 (2002) 219–230

Tripathy, D.N., 1983. Pasteurella anatipestifer and its control in ducks. In: Proceedings of a Meeting held on Disease Prevention and Control in Poultry Production, Series No. 66, Manly, pp. 125–127. Vogt, J., Schulz, G.E., 1999. The structure of the outer membrane protein OmpX from Escherichia coli reveals possible mechanisms of virulence. Struc. Fold Des. 7, 1301–1309. Wedege, E., Hoiby, E.A., Rosenqvist, E., Bjune, G., 1998. Immune responses against major outer membrane antigens of Neisseria meningitidis in vaccinees and controls who contracted meningococcal disease during the Norwegian serogroup B protection trial. Infect. Immun. 66, 3223–3231. Weiser, J.N., Gotschlich, E.C., 1991. Outer membrane protein A (OmpA) contributes to serum resistance and pathogenicity of Escherichia coli K-1. Infect. Immun. 59, 2252–2258.


相关文章:
更多相关标签: